Mutants (Isolated)

tm3007

Allele Nametm3007
Allele TypeNormal
Sequence NameC52B11.5
Gene NameC52B11.5
Worm BaseAllele Name tm3007
Gene Name C52B11.5
Sequence C52B11.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1229/1230-1727/1728 (498 bp deletion)
ChromosomeX
Putative gene structurejoin(85..141, 898..1075, 1125..1165, 1412..1513, 1572..1693, 1735..1840, 2231..2341)
Map position-18.49
Balancer
Map position of balancer
Sequence of primersExtFwd:GTGTCAGTATTAGAGGGCAA,ExtRev:GTATTCCAGGAAGCGTCTAG,IntFwd:GTGAAGCACTTCAGCACTAG,IntRev:TGGTCTCCAGAATGTCATGC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671 
[ PubMed ID = 32009302 ] [ RRC reference ]