分離済み変異体

tm3006

Allele Nametm3006
BalanceNot Required
OutCrossNot Accepted
Sequence NameF52B10.2
Gene Namehst-3.2
Worm BaseAllele Name tm3006
Gene Name hst-3.2
Sequence F52B10.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21521/21522-21751/21752 (230 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(21140..21345, 21395..21682, 21732..21886, 26090..26316))
Map position-12.67
Balancer
Map position of balancer
Sequence of primersExtFwd:TAGAACCGATGGCTCAACGT,IntFwd:GGCTCAACGTCTGGATGATG,ExtRev:GCTGGGGTCGAAGTTACGCA,IntRev:ACGGAAGGGCAGTAGATTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cizeron M, Granger L, Bülow HE, Bessereau JL.
Specific heparan sulfate modifications stabilize the synaptic organizer MADD-4/Punctin at Caenorhabditis elegans neuromuscular junctions.
Genetics 2021 218(4)  
[ PubMed ID = 33983408 ] [ RRC reference ]

Lázaro-Peña MI, Díaz-Balzac CA, Bülow HE, Emmons SW.
Synaptogenesis Is Modulated by Heparan Sulfate in Caenorhabditis elegans.
Genetics 2018 209(1) 195-208 
[ PubMed ID = 29559501 ] [ RRC reference ]

Díaz-Balzac CA, Lázaro-Peña MI, Tecle E, Gomez N, Bülow HE.
Complex cooperative functions of heparan sulfate proteoglycans shape nervous system development in Caenorhabditis elegans.
G3 (Bethesda) 2014 4(10) 1859-70 
[ PubMed ID = 25098771 ] [ RRC reference ]

Edwards TJ, Hammarlund M.
Syndecan promotes axon regeneration by stabilizing growth cone migration.
Cell Rep 2014 8(1) 272-83 
[ PubMed ID = 25001284 ] [ RRC reference ]

Tecle E, Diaz-Balzac CA, Bülow HE.
Distinct 3-O-sulfated heparan sulfate modification patterns are required for kal-1-dependent neurite branching in a context-dependent manner in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(3) 541-52 
[ PubMed ID = 23451335 ] [ RRC reference ]

Gysi S, Rhiner C, Flibotte S, Moerman DG, Hengartner MO.
A network of HSPG core proteins and HS modifying enzymes regulates netrin-dependent guidance of D-type motor neurons in Caenorhabditis elegans.
PLoS One 2013 8(9) e74908 
[ PubMed ID = 24066155 ] [ RRC reference ]

Attreed M, Desbois M, van Kuppevelt TH, Bülow HE.
Direct visualization of specifically modified extracellular glycans in living animals.
Nat Methods 2012 9(5) 477-9 
[ PubMed ID = 22466794 ] [ RRC reference ]