分離済み変異体

tm2995

Allele Nametm2995
BalanceNot Required
OutCrossNot Accepted
Sequence NameY17G7B.1
Gene Nameacbp-6
Worm BaseAllele Name tm2995
Gene Name acbp-6
Sequence Y17G7B.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3534/3535-ACCCACATCCTCATTTGGAATGTC-3801/3802 (267 bp deletion + 24 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(3569..3750, 3804..3945, 4851..4874))
Map position5.12
Balancer
Map position of balancer
Sequence of primersExtRev:GCGGCTAATTTGAAACGCTC,IntRev:GGCGTCCAAATTTGGCGGTA,ExtFwd:TCACTCTCTCTATCGGTGTC,IntFwd:GATACCCACCGACCCAGAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Saul J, Hirose T, Horvitz HR.
The transcriptional corepressor CTBP-1 acts with the SOX family transcription factor EGL-13 to maintain AIA interneuron cell identity in Caenorhabditis elegans.
Elife 2022 11  
[ PubMed ID = 35119366 ] [ RRC reference ]

Charmpilas N, Ruckenstuhl C, Sica V, Büttner S, Habernig L, Dichtinger S, Madeo F, Tavernarakis N, Bravo-San Pedro JM, Kroemer G.
Acyl-CoA-binding protein (ACBP): a phylogenetically conserved appetite stimulator.
Cell Death Dis 2020 11(1) 7 
[ PubMed ID = 31907349 ] [ RRC reference ]

Elle IC, Simonsen KT, Olsen LC, Birck PK, Ehmsen S, Tuck S, Le TT, Færgeman NJ.
Tissue- and paralogue-specific functions of acyl-CoA-binding proteins in lipid metabolism in Caenorhabditis elegans.
Biochem J 2011 437(2) 231-41 
[ PubMed ID = 21539519 ] [ RRC reference ]