| Allele Name | tm2995 |
| Allele Type | 通常株 |
| Sequence Name | Y17G7B.1 |
| Gene Name | acbp-6 |
| Worm Base | Allele Name |
tm2995
|
| Gene Name |
acbp-6
|
| Sequence |
Y17G7B.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 3534/3535-ACCCACATCCTCATTTGGAATGTC-3801/3802 (267 bp deletion + 24 bp insertion) |
| Chromosome | II |
| Putative gene structure | complement(join(3569..3750, 3804..3945, 4851..4874)) |
| Map position | 5.12 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GCGGCTAATTTGAAACGCTC,IntRev:GGCGTCCAAATTTGGCGGTA,ExtFwd:TCACTCTCTCTATCGGTGTC,IntFwd:GATACCCACCGACCCAGAAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Saul J, Hirose T, Horvitz HR.
The transcriptional corepressor CTBP-1 acts with the SOX family transcription factor EGL-13 to maintain AIA interneuron cell identity in Caenorhabditis elegans.
Elife 2022 11
[ PubMed ID = 35119366 ]
[ RRC reference ]
|
Charmpilas N, Ruckenstuhl C, Sica V, Büttner S, Habernig L, Dichtinger S, Madeo F, Tavernarakis N, Bravo-San Pedro JM, Kroemer G.
Acyl-CoA-binding protein (ACBP): a phylogenetically conserved appetite stimulator.
Cell Death Dis 2020 11(1) 7
[ PubMed ID = 31907349 ]
[ RRC reference ]
|
Elle IC, Simonsen KT, Olsen LC, Birck PK, Ehmsen S, Tuck S, Le TT, Færgeman NJ.
Tissue- and paralogue-specific functions of acyl-CoA-binding proteins in lipid metabolism in Caenorhabditis elegans.
Biochem J 2011 437(2) 231-41
[ PubMed ID = 21539519 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.