Mutants (Isolated)

tm2943

Allele Nametm2943
Sequence NameT24A6.5
CGC Namesrbc-66
Worm BaseAllele Name tm2943
CGC Name srbc-66
Sequence T24A6.5
Phenotypehomozygous viable.
Mutation site5667/5668-5960/5961 (293 bp deletion)
ChromosomeV
Putative gene structurejoin(5633..5807, 5999..6456, 7083..7310)
Map position-9.95
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCCACCTGACTTGTTAGTC,ExtRev:GGGTGCTGCGAAACATGCAC,IntFwd:AACCCCATCAGCTAATACGA,IntRev:ATTCGCATGAATCGCCACAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhou Y, Loeza-Cabrera M, Liu Z, Aleman-Meza B, Nguyen JK, Jung SK, Choi Y, Shou Q, Butcher RA, Zhong W.
Potential Nematode Alarm Pheromone Induces Acute Avoidance in Caenorhabditis elegans.
Genetics 2017 206(3) 1469-1478 
[ PubMed ID = 28495959 ] [ RRC reference ]

Yamada K, Hirotsu T, Matsuki M, Butcher RA, Tomioka M, Ishihara T, Clardy J, Kunitomo H, Iino Y.
Olfactory plasticity is regulated by pheromonal signaling in Caenorhabditis elegans.
Science 2010 329(5999) 1647-50 
[ PubMed ID = 20929849 ] [ RRC reference ]

Kim K, Sato K, Shibuya M, Zeiger DM, Butcher RA, Ragains JR, Clardy J, Touhara K, Sengupta P.
Two chemoreceptors mediate developmental effects of dauer pheromone in C. elegans.
Science 2009 326(5955) 994-8 
[ PubMed ID = 19797623 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705 
[ PubMed ID = 27172180 ] [ RRC reference ]

Neal SJ, Park J, DiTirro D, Yoon J, Shibuya M, Choi W, Schroeder FC, Butcher RA, Kim K, Sengupta P.
A Forward Genetic Screen for Molecules Involved in Pheromone-Induced Dauer Formation in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1475-87 
[ PubMed ID = 26976437 ] [ RRC reference ]