Mutants (Isolated)

tm294

Allele Nametm294
Allele TypeNormal
Sequence NameF17A9.3
Gene NameF17A9.3
Worm BaseAllele Name tm294
Gene Name F17A9.3
Sequence F17A9.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4177/4178-5052/5053 (875 bp deletion)
ChromosomeV
Putative gene structurejoin(3201..3362, 3801..3866, 3923..4027, 4413..4634, 4693..4863)
Map position-3.68
Balancer
Map position of balancer
Sequence of primersIntRev:CGTTTCCGTTCATTCTACTG,ExtRev:ATTGCGAACCTTCGGGTCGT,IntFwd:TTGACGTATCACCCTACTCT,ExtFwd:ATGGCTTCATGTCATGAACC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cabianca DS, Muñoz-Jiménez C, Kalck V, Gaidatzis D, Padeken J, Seeber A, Askjaer P, Gasser SM.
Active chromatin marks drive spatial sequestration of heterochromatin in C. elegans nuclei.
Nature 2019 569(7758) 734-739 
[ PubMed ID = 31118512 ] [ RRC reference ]