Mutants (Isolated)

tm2895

Allele Nametm2895
Sequence NameR05H10.5
CGC NameR05H10.5
Worm BaseAllele Name tm2895
CGC Name R05H10.5
Sequence R05H10.5
Phenotypehomozygous viable.
Mutation site40879/40880-41386/41387 (507 bp deletion)
ChromosomeIII
Putative gene structurejoin(40653..40720, 40819..40905, 41670..42006)
Map position-0.79
Balancer
Map position of balancer
Sequence of primersIntFwd:CTCTCAACCGCATCCGCAAT,ExtFwd:CGCTCGTCGTTTCATCTCAC,IntRev:ACGGGAATGCGAGAACTTCG,ExtRev:TGATGGTTCCTGACCACCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sakamoto T, Maebayashi K, Nakagawa Y, Imai H.
Deletion of the four phospholipid hydroperoxide glutathione peroxidase genes accelerates aging in Caenorhabditis elegans.
Genes Cells 2014 19(10) 778-92 
[ PubMed ID = 25200408 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]