分離済み変異体

tm284

Allele Nametm284
BalanceNot Required
OutCrossNot Accepted
Sequence NameF31A3.4
Gene Namehlh-29
Worm BaseAllele Name tm284
Gene Name hlh-29
Sequence F31A3.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. R. Lin, Dr. M. Maduro: normal cell division during 8-30 cell stage. Dr. P. Sengupta: normal dye-filling into sensory neurons. Dr. J. Priess: Dev. Cell 8, 867-879 (2005). Dr. O. Hobert: ASE & AIY fate markers normal. Dr. C.M. Johnson: BBA 1769, 5 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15502/15503-17344/17345 (1842 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(16105..16429, 16479..16703, 16756..16925))
Map position24.06
Balancer
Map position of balancer
Sequence of primersExtFwd:TACACAGCGATCCAGCATTT,IntFwd:CCGTTGCTACCTTAGAAATG,IntRev:GGCATAGGATCACAAAAAGG,ExtRev:CGTCTATTTAACTCCGCCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Quach TK, Chou HT, Wang K, Milledge GZ, Johnson CM.
Genome-wide microarrray analysis reveals roles for the REF-1 family member HLH-29 in ferritin synthesis and peroxide stress response.
PLoS One 2013 8(3) e59719 
[ PubMed ID = 23533643 ] [ RRC reference ]

White A, Fearon A, Johnson CM.
HLH-29 regulates ovulation in C. elegans by targeting genes in the inositol triphosphate signaling pathway.
Biol Open 2012 1(3) 261-8 
[ PubMed ID = 23213416 ] [ RRC reference ]

McMiller TL, Sims D, Lee T, Williams T, Johnson CM.
Molecular characterization of the Caenorhabditis elegans REF-1 family member, hlh-29/hlh-28.
Biochim Biophys Acta 2007 1769(1) 5-19 
[ PubMed ID = 17258327 ] [ RRC reference ]

Lanjuin A, Claggett J, Shibuya M, Hunter CP, Sengupta P.
Regulation of neuronal lineage decisions by the HES-related bHLH protein REF-1.
Dev Biol 2006 290(1) 139-51 
[ PubMed ID = 16376329 ] [ RRC reference ]

Neves A, Priess JR.
The REF-1 family of bHLH transcription factors pattern C. elegans embryos through Notch-dependent and Notch-independent pathways.
Dev Cell 2005 8(6) 867-79 
[ PubMed ID = 15935776 ] [ RRC reference ]