| Allele Name | tm284 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F31A3.4 |
| Gene Name | hlh-29 |
| Worm Base | Allele Name |
tm284
|
| Gene Name |
hlh-29
|
| Sequence |
F31A3.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. R. Lin, Dr. M. Maduro: normal cell division during 8-30 cell stage. Dr. P. Sengupta: normal dye-filling into sensory neurons. Dr. J. Priess: Dev. Cell 8, 867-879 (2005). Dr. O. Hobert: ASE & AIY fate markers normal. Dr. C.M. Johnson: BBA 1769, 5 (2007). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 15502/15503-17344/17345 (1842 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(16105..16429, 16479..16703, 16756..16925)) |
| Map position | 24.06 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TACACAGCGATCCAGCATTT,IntFwd:CCGTTGCTACCTTAGAAATG,IntRev:GGCATAGGATCACAAAAAGG,ExtRev:CGTCTATTTAACTCCGCCTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Quach TK, Chou HT, Wang K, Milledge GZ, Johnson CM. Genome-wide microarrray analysis reveals roles for the REF-1 family member HLH-29 in ferritin synthesis and peroxide stress response. PLoS One 2013 8(3) e59719
[ PubMed ID = 23533643 ]
[ RRC reference ]
|
White A, Fearon A, Johnson CM. HLH-29 regulates ovulation in C. elegans by targeting genes in the inositol triphosphate signaling pathway. Biol Open 2012 1(3) 261-8
[ PubMed ID = 23213416 ]
[ RRC reference ]
|
McMiller TL, Sims D, Lee T, Williams T, Johnson CM. Molecular characterization of the Caenorhabditis elegans REF-1 family member, hlh-29/hlh-28. Biochim Biophys Acta 2007 1769(1) 5-19
[ PubMed ID = 17258327 ]
[ RRC reference ]
|
Lanjuin A, Claggett J, Shibuya M, Hunter CP, Sengupta P. Regulation of neuronal lineage decisions by the HES-related bHLH protein REF-1. Dev Biol 2006 290(1) 139-51
[ PubMed ID = 16376329 ]
[ RRC reference ]
|
Neves A, Priess JR. The REF-1 family of bHLH transcription factors pattern C. elegans embryos through Notch-dependent and Notch-independent pathways. Dev Cell 2005 8(6) 867-79
[ PubMed ID = 15935776 ]
[ RRC reference ]
|
|