Mutants (Isolated)

tm282

Allele Nametm282
Sequence NameF21H11.3
CGC Nametbx-2
Worm BaseAllele Name tm282
CGC Name tbx-2
Sequence F21H11.3
Phenotypelethal or sterile. Dr. P. Okkema: L1 arrest with pharyngeal defects, recessive.
Mutation site23251/23252-24907/24908 (1656 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(22089..22682, 23313..23459, 24254..24330, 24576..24766, 26666..26928))
Map position-2.17
BalancereT1,dpy-17 (e164) III
Map position of balancer-2.22
Sequence of primersExtRev:AAGAGAGAGCACAACGGACT,IntFwd:TTTGGGTGGTGTCACTGACT,IntRev:TTTGCCTCAGTTGGATATCG,ExtFwd:CACCGTTAAAAAGCTCGTTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Roy Chowdhuri S, Crum T, Woollard A, Aslam S, Okkema PG.
The T-box factor TBX-2 and the SUMO conjugating enzyme UBC-9 are required for ABa-derived pharyngeal muscle in C. elegans.
Dev. Biol. 2006 295(2) 664-77 
[ PubMed ID = 16701625 ] [ RRC reference ]