Mutants (Isolated)

tm2807

Allele Nametm2807
Sequence NameD1005.3
CGC Namecebp-1
Worm BaseAllele Name tm2807
CGC Name cebp-1
Sequence D1005.3
Phenotypehomozygous viable. Dr. K. Matsumoto: not sensitive to copper.
Mutation site542/543-1021/1022 (479 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(49..109, 159..904, 954..1116, 1170..1276))
Map position-18.11
Balancer
Map position of balancer
Sequence of primersExtRev:CATTCCTCTCGCCCCGCATA,IntRev:GGCGTTGTGACTCATCGCAA,ExtFwd:AGGATGTGGCGTTGGGGCAT,IntFwd:TGCTCTTTCATCGGGCCTCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Malinow RA, Ying P, Koorman T, Boxem M, Jin Y, Kim KW.
Functional Dissection of C. elegans bZip-Protein CEBP-1 Reveals Novel Structural Motifs Required for Axon Regeneration and Nuclear Import.
Front Cell Neurosci 2019 13 348 
[ PubMed ID = 31417366 ] [ RRC reference ]

Kim KW, Thakur N, Piggott CA, Omi S, Polanowska J, Jin Y, Pujol N.
Coordinated inhibition of C/EBP by Tribbles in multiple tissues is essential for Caenorhabditis elegans development.
BMC Biol. 2016 14(1) 104 
[ PubMed ID = 27927209 ] [ RRC reference ]

Park EC, Rongo C.
RPM-1 and DLK-1 regulate pioneer axon outgrowth by controlling Wnt signaling.
Development 2018 145(18)  
[ PubMed ID = 30093552 ] [ RRC reference ]

McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, Sadreyev R, Ausubel FM.
Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.
BMC Biol. 2016 14(1) 105 
[ PubMed ID = 27927200 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J. Cell Biol. 2019 218(1) 125-133 
[ PubMed ID = 30396999 ] [ RRC reference ]

Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J. Neurosci. 2010 30(9) 3175-83 
[ PubMed ID = 20203177 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83 
[ PubMed ID = 25437544 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr. Biol. 2015 25(12) 1594-605 
[ PubMed ID = 26051896 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet. 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]

Li C, Hisamoto N, Matsumoto K.
Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways.
PLoS Genet. 2015 11(10) e1005603 
[ PubMed ID = 26484536 ] [ RRC reference ]

Noma K, Goncharov A, Jin Y.
Systematic analyses of rpm-1 suppressors reveal roles for ESS-2 in mRNA splicing in Caenorhabditis elegans.
Genetics 2014 198(3) 1101-15 
[ PubMed ID = 25194163 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(46) 16568-73 
[ PubMed ID = 25359212 ] [ RRC reference ]

Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18 
[ PubMed ID = 19737525 ] [ RRC reference ]