分離済み変異体

tm2807

Allele Nametm2807
BalanceNot Required
OutCrossNot Accepted
Sequence NameD1005.3
Gene Namecebp-1
Worm BaseAllele Name tm2807
Gene Name cebp-1
Sequence D1005.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Matsumoto: not sensitive to copper.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 542/543-1021/1022 (479 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(49..109, 159..904, 954..1116, 1170..1276))
Map position-18.11
Balancer
Map position of balancer
Sequence of primersExtRev:CATTCCTCTCGCCCCGCATA,IntRev:GGCGTTGTGACTCATCGCAA,ExtFwd:AGGATGTGGCGTTGGGGCAT,IntFwd:TGCTCTTTCATCGGGCCTCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sun Y, Zhou J, Debnath A, Xie B, Wang Z, Jin Y.
Multiple regulators constrain the abundance of Caenorhabditis elegans DLK-1 in ciliated sensory neurons.
G3 (Bethesda) 2025 15(3)  
[ PubMed ID = 39854273 ] [ RRC reference ]

Malinow RA, Zhu M, Jin Y, Kim KW.
Forward genetic screening identifies novel roles for N-terminal acetyltransferase C and histone deacetylase in C. elegans development.
Sci Rep 2022 12(1) 16438 
[ PubMed ID = 36180459 ] [ RRC reference ]

Haerkens F, Kikken C, Kirkels L, van Amstel M, Wouters W, van Doornmalen E, Francke C, Hughes S.
A new use for old drugs: identifying compounds with an anti-obesity effect using a high through-put semi-automated Caenorhabditis elegans screening platform.
Heliyon 2022 8(8) e10108 
[ PubMed ID = 36033279 ] [ RRC reference ]

Ding C, Wu Y, Dabas H, Hammarlund M.
Activation of the CaMKII-Sarm1-ASK1-p38 MAP kinase pathway protects against axon degeneration caused by loss of mitochondria.
Elife 2022 11  
[ PubMed ID = 35285800 ] [ RRC reference ]

Kulkarni SS, Sabharwal V, Sheoran S, Basu A, Matsumoto K, Hisamoto N, Ghosh-Roy A, Koushika SP.
UNC-16 alters DLK-1 localization and negatively regulates actin and microtubule dynamics in Caenorhabditis elegans regenerating neurons.
Genetics 2021 219(3)  
[ PubMed ID = 34740241 ] [ RRC reference ]

Wu C, Karakuzu O, Garsin DA.
Tribbles pseudokinase NIPI-3 regulates intestinal immunity in Caenorhabditis elegans by controlling SKN-1/Nrf activity.
Cell Rep 2021 36(7) 109529 
[ PubMed ID = 34407394 ] [ RRC reference ]

Caito SW, Newell-Caito J, Martell M, Crawford N, Aschner M.
Methylmercury Induces Metabolic Alterations in Caenorhabditis elegans: Role for C/EBP Transcription Factor.
Toxicol Sci 2020 174(1) 112-123 
[ PubMed ID = 31851340 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J Cell Biol 2019 218(1) 125-133 
[ PubMed ID = 30396999 ] [ RRC reference ]

Malinow RA, Ying P, Koorman T, Boxem M, Jin Y, Kim KW.
Functional Dissection of C. elegans bZip-Protein CEBP-1 Reveals Novel Structural Motifs Required for Axon Regeneration and Nuclear Import.
Front Cell Neurosci 2019 13 348 
[ PubMed ID = 31417366 ] [ RRC reference ]

Park EC, Rongo C.
RPM-1 and DLK-1 regulate pioneer axon outgrowth by controlling Wnt signaling.
Development 2018 145(18)  
[ PubMed ID = 30093552 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]

McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, Sadreyev R, Ausubel FM.
Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.
BMC Biol 2016 14(1) 105 
[ PubMed ID = 27927200 ] [ RRC reference ]

Kim KW, Thakur N, Piggott CA, Omi S, Polanowska J, Jin Y, Pujol N.
Coordinated inhibition of C/EBP by Tribbles in multiple tissues is essential for Caenorhabditis elegans development.
BMC Biol 2016 14(1) 104 
[ PubMed ID = 27927209 ] [ RRC reference ]

Li C, Hisamoto N, Matsumoto K.
Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways.
PLoS Genet 2015 11(10) e1005603 
[ PubMed ID = 26484536 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr Biol 2015 25(12) 1594-605 
[ PubMed ID = 26051896 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc Natl Acad Sci U S A 2014 111(46) 16568-73 
[ PubMed ID = 25359212 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83 
[ PubMed ID = 25437544 ] [ RRC reference ]

Noma K, Goncharov A, Jin Y.
Systematic analyses of rpm-1 suppressors reveal roles for ESS-2 in mRNA splicing in Caenorhabditis elegans.
Genetics 2014 198(3) 1101-15 
[ PubMed ID = 25194163 ] [ RRC reference ]

Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J Neurosci 2010 30(9) 3175-83 
[ PubMed ID = 20203177 ] [ RRC reference ]

Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18 
[ PubMed ID = 19737525 ] [ RRC reference ]