Mutants (Isolated)

tm2807

Allele Name

tm2807

Sequence Name

D1005.3

CGC Name

cebp-1

Worm Base

Allele Name

tm2807

CGC Name

cebp-1

Sequence

D1005.3

Phenotype

homozygous viable. Dr. K. Matsumoto: not sensitive to copper.

Mutation site

542/543-1021/1022 (479 bp deletion)

Chromosome

Putative gene structure

complement(join(49..109, 159..904, 954..1116, 1170..1276))

Map position

-18.11

Balancer

Map position of balancer

Sequence of primers

ExtRev:CATTCCTCTCGCCCCGCATA,IntRev:GGCGTTGTGACTCATCGCAA,ExtFwd:AGGATGTGGCGTTGGGGCAT,IntFwd:TGCTCTTTCATCGGGCCTCT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Malinow RA, Ying P, Koorman T, Boxem M, Jin Y, Kim KW.
Functional Dissection of C. elegans bZip-Protein CEBP-1 Reveals Novel Structural Motifs Required for Axon Regeneration and Nuclear Import.
Front Cell Neurosci 2019 13 348
[ PubMed ID = 31417366 ] [ RRC reference ]

Caito SW, Newell-Caito J, Martell M, Crawford N, Aschner M.
Methylmercury Induces Metabolic Alterations in Caenorhabditis elegans: Role for C/EBP Transcription Factor.
Toxicol Sci 2020 174(1) 112-123
[ PubMed ID = 31851340 ] [ RRC reference ]

Noblett N, Wu Z, Ding ZH, Park S, Roenspies T, Flibotte S, Chisholm AD, Jin Y, Colavita A.
DIP-2 suppresses ectopic neurite sprouting and axonal regeneration in mature neurons.
J Cell Biol 2019 218(1) 125-133
[ PubMed ID = 30396999 ] [ RRC reference ]

Park EC, Rongo C.
RPM-1 and DLK-1 regulate pioneer axon outgrowth by controlling Wnt signaling.
Development 2018 145(18)
[ PubMed ID = 30093552 ] [ RRC reference ]

Kim KW, Thakur N, Piggott CA, Omi S, Polanowska J, Jin Y, Pujol N.
Coordinated inhibition of C/EBP by Tribbles in multiple tissues is essential for Caenorhabditis elegans development.
BMC Biol 2016 14(1) 104
[ PubMed ID = 27927209 ] [ RRC reference ]

McEwan DL, Feinbaum RL, Stroustrup N, Haas W, Conery AL, Anselmo A, Sadreyev R, Ausubel FM.
Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.
BMC Biol 2016 14(1) 105
[ PubMed ID = 27927200 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet 2017 13(6) e1006876
[ PubMed ID = 28662060 ] [ RRC reference ]

Ghosh-Roy A, Wu Z, Goncharov A, Jin Y, Chisholm AD.
Calcium and cyclic AMP promote axonal regeneration in Caenorhabditis elegans and require DLK-1 kinase.
J Neurosci 2010 30(9) 3175-83
[ PubMed ID = 20203177 ] [ RRC reference ]

Noma K, Goncharov A, Jin Y.
Systematic analyses of rpm-1 suppressors reveal roles for ESS-2 in mRNA splicing in Caenorhabditis elegans.
Genetics 2014 198(3) 1101-15
[ PubMed ID = 25194163 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83
[ PubMed ID = 25437544 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr Biol 2015 25(12) 1594-605
[ PubMed ID = 26051896 ] [ RRC reference ]

Li C, Hisamoto N, Matsumoto K.
Axon Regeneration Is Regulated by Ets-C/EBP Transcription Complexes Generated by Activation of the cAMP/Ca2+ Signaling Pathways.
PLoS Genet 2015 11(10) e1005603
[ PubMed ID = 26484536 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc Natl Acad Sci U S A 2014 111(46) 16568-73
[ PubMed ID = 25359212 ] [ RRC reference ]

Yan D, Wu Z, Chisholm AD, Jin Y.
The DLK-1 kinase promotes mRNA stability and local translation in C. elegans synapses and axon regeneration.
Cell 2009 138(5) 1005-18
[ PubMed ID = 19737525 ] [ RRC reference ]