Mutants (Isolated)

tm278

Allele Nametm278
Sequence NameF40H6.4
CGC Nametbx-11
Worm BaseAllele Name tm278
CGC Name tbx-11
Sequence F40H6.4
Phenotypehomozygous viable. Dr. R. Lin: Dev. Biol. 276, 493-507 (2004).
Mutation site11025/11026-11699/11700 (674 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(11400..11873, 12040..12534))
Map position-1.39
Balancer
Map position of balancer
Sequence of primersIntRev:GAAAGAAATCCATGGGTCTG,ExtFwd:CTAGGGTGACAACTCTTGAA,ExtRev:TTGACACAGAGGAACGCTTT,IntFwd:TCAGGGGACCCCAACCTATA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Robertson SM, Shetty P, Lin R.
Identification of lineage-specific zygotic transcripts in early Caenorhabditis elegans embryos.
Dev. Biol. 2004 276(2) 493-507 
[ PubMed ID = 15581881 ] [ RRC reference ]