Mutants (Isolated)

tm2772

Allele Nametm2772
BalanceNot Required
OutCrossNot Accepted
Sequence NameF47G4.7
Gene Namesmd-1
Worm BaseAllele Name tm2772
Gene Name smd-1
Sequence F47G4.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K.F. O'Connell: normal hatching, locomotion and body shape.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 568/569-1346/1347 (778 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(AL023853.1:7169..7264, 472..601, 649..866, 916..1578))
Map position22.88
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGAACCCACCTCAAGTCTC,IntFwd:CTTCTATACCCCGGCAGCTC,ExtRev:TCCGTCTTTCGACATACCCA,IntRev:GCCACGTCTGCCACCAACTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stegehake D, Kurosinski MA, Schürmann S, Daniel J, Lüersen K, Liebau E.
Polyamine-independent Expression of Caenorhabditis elegans Antizyme.
J Biol Chem 2015 290(29) 18090-18101 
[ PubMed ID = 26032421 ] [ RRC reference ]

Heinick A, Urban K, Roth S, Spies D, Nunes F, Phanstiel O 4th, Liebau E, Lüersen K.
Caenorhabditis elegans P5B-type ATPase CATP-5 operates in polyamine transport and is crucial for norspermidine-mediated suppression of RNA interference.
FASEB J 2010 24(1) 206-17 
[ PubMed ID = 19762559 ] [ RRC reference ]