| Allele Name | tm2751 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | Y45G12B.1 |
| Gene Name | nuo-5 |
| Worm Base | Allele Name |
tm2751
(x1) |
| Gene Name |
nuo-5
|
| Sequence |
Y45G12B.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 11878/11879-TA-12276/12277 (398 bp deletion + 2 bp insertion) |
| Chromosome | V |
| Putative gene structure | join(10417..10509, 11714..12466, 14346..15313, 16680..16809, 17930..18175) |
| Map position | -13.42 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTCGACCCGGGAATGACGAT,IntFwd:CCGGGAATGACGATTCTCCA,ExtRev:TAACCCGCAGAAGCTCGCCA,IntRev:GCCAGTCCGATGCGAAAGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V. Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis. Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ]
[ RRC reference ]
|
Meisel JD, Miranda M, Skinner OS, Wiesenthal PP, Wellner SM, Jourdain AA, Ruvkun G, Mootha VK. Hypoxia and intra-complex genetic suppressors rescue complex I mutants by a shared mechanism. Cell 2024 187(3) 659-675.e18
[ PubMed ID = 38215760 ]
[ RRC reference ]
|
|