Mutants (Isolated)

tm2740

Allele Nametm2740
Sequence NameB0001.4
CGC NameB0001.4
Worm BaseAllele Name tm2740
CGC Name B0001.4
Sequence B0001.4
Phenotypehomozygous viable
Mutation site10069/10070-CT-10333/10334 (264 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(8988..9092, 9724..10042, 10176..10375, 10699..10758, 10806..10868))
Map position5.73
Balancer
Map position of balancer
Sequence of primersIntRev:GTCCACTTGTCACTTCACTC,IntFwd:AGCGTGCTTCATGAGGTTGA,ExtRev:GGCATGGCAATTTGCCGGTT,ExtFwd:ATGCGTTAAGCGTGCTTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim S, Park DH, Kim TH, Hwang M, Shim J.
Functional analysis of pyrimidine biosynthesis enzymes using the anticancer drug 5-fluorouracil in Caenorhabditis elegans.
FEBS J. 2009 276(17) 4715-26 
[ PubMed ID = 19645718 ] [ RRC reference ]