分離済み変異体

tm2725

Allele Nametm2725
BalanceNot Required
OutCrossNot Accepted
Sequence NameY39A1C.4
Gene Namehex-3
Worm BaseAllele Name tm2725
Gene Name hex-3
Sequence Y39A1C.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. I. Wilson: J. Biol. Chem. 282, 27825 (2007). Dr. C. Yang: normal cell death phenotype.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 41/42-GAGAG-187/188 (146 bp deletion + 5 bp insertion)
ChromosomeIII
Putative gene structurejoin(Z92809.1:18846..18983, Z92809.1:19743..20019, 107..459, 1396..1809, 2410..2760, 3707..3860, 4109..4269)
Map position5.45
Balancer
Map position of balancer
Sequence of primersExtFwd:AAAGCTCAGGAGCCAGCAGC,IntFwd:AAGCCGTCTCGTCAACCCCA,ExtRev:CTCCCTACCTGAAAAGCCTC,IntRev:AGCCTCATCGGCTCCAATAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kendler J, Wӧls F, Thapliyal S, Arcalis E, Gabriel H, Kubitschek S, Malzl D, Strobl MR, Palmberger D, Luber T, Unverzagt C, Paschinger K, Glauser DA, Wilson IBH, Yan S.
N-glycan core tri-fucosylation requires Golgi α-mannosidase III activity that impacts nematode growth and behavior.
J Biol Chem 2024 300(12) 107944 
[ PubMed ID = 39481603 ] [ RRC reference ]

Zárate-Potes A, Yang W, Pees B, Schalkowski R, Segler P, Andresen B, Haase D, Nakad R, Rosenstiel P, Tetreau G, Colletier JP, Schulenburg H, Dierking K.
The C. elegans GATA transcription factor elt-2 mediates distinct transcriptional responses and opposite infection outcomes towards different Bacillus thuringiensis strains.
PLoS Pathog 2020 16(9) e1008826 
[ PubMed ID = 32970778 ] [ RRC reference ]

Wohlschlager T, Butschi A, Grassi P, Sutov G, Gauss R, Hauck D, Schmieder SS, Knobel M, Titz A, Dell A, Haslam SM, Hengartner MO, Aebi M, Künzler M.
Methylated glycans as conserved targets of animal and fungal innate defense.
Proc Natl Acad Sci U S A 2014 111(27) E2787-96 
[ PubMed ID = 24879441 ] [ RRC reference ]

Gutternigg M, Kretschmer-Lubich D, Paschinger K, Rendić D, Hader J, Geier P, Ranftl R, Jantsch V, Lochnit G, Wilson IB.
Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.
J Biol Chem 2007 282(38) 27825-40 
[ PubMed ID = 17636254 ] [ RRC reference ]