Mutants (Isolated)

tm272

Allele Nametm272
Sequence NameC33D12.7
CGC Nameceh-30
Worm BaseAllele Name tm272
CGC Name ceh-30
Sequence C33D12.7
Phenotypehomozygous viable. Dr. P. Sengupta: normal development of AWA neurons.
Mutation site22743/22744-23199/23200 (456 bp deletion)
ChromosomeX
Putative gene structurejoin(21713..21880, 21949..22150, 22427..22682, 23349..23622)
Map position-11.91
Balancer
Map position of balancer
Sequence of primersIntRev:CCTGTCGCTTCCATTTTGTT,ExtRev:TTCTGAACTGCGGAGAGGTT,ExtFwd:GCGCGCCCAATATTTTACGC,IntFwd:GGACGGAACGATCATCTTGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Srinivasan J, Kaplan F, Ajredini R, Zachariah C, Alborn HT, Teal PE, Malik RU, Edison AS, Sternberg PW, Schroeder FC.
A blend of small molecules regulates both mating and development in Caenorhabditis elegans.
Nature 2008 454(7208) 1115-8 
[ PubMed ID = 18650807 ] [ RRC reference ]

Sakai N, Iwata R, Yokoi S, Butcher RA, Clardy J, Tomioka M, Iino Y.
A sexually conditioned switch of chemosensory behavior in C. elegans.
PLoS ONE 2013 8(7) e68676 
[ PubMed ID = 23861933 ] [ RRC reference ]

Peden E, Kimberly E, Gengyo-Ando K, Mitani S, Xue D.
Control of sex-specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho.
Genes Dev. 2007 21(23) 3195-207 
[ PubMed ID = 18056429 ] [ RRC reference ]