Mutants (Isolated)

tm2713

Allele Nametm2713
BalanceCompleted
OutCrossNot Accepted
Sequence NameH27M09.3
Gene Namesyp-4
Worm BaseAllele Name tm2713 (x1)
Gene Name syp-4
Sequence H27M09.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M.P. Colaiacovo: PLoS Genetics 5, 10, e1000669 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 5648/5649-5861/5862 (213 bp deletion)
ChromosomeI
Putative gene structurejoin(5521..5586, 5632..5728, 5775..5943, 6014..6297, 6353..6558, 6620..7199, 7246..7389, 7436..7707)
Map position1.39
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:AATGTCGTTTCCGACGCTAC,ExtRev:TCTCCCGCTGATGTACCCTT,IntFwd:CTGCGATGCCATGAGGTATT,IntRev:CGCTGATGTACCCTTGCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Köhler S, Wojcik M, Xu K, Dernburg AF.
Dynamic molecular architecture of the synaptonemal complex.
Sci Adv 2025 11(4) eadq9374 
[ PubMed ID = 39841849 ] [ RRC reference ]

Gros O, Passmore JB, Borst NO, Kutra D, Nijenhuis W, Fuqua T, Kapitein LC, Crocker JM, Kreshuk A, Köhler S.
Spherical harmonics texture extraction for versatile analysis of biological objects.
PLoS Comput Biol 2025 21(1) e1012349 
[ PubMed ID = 39879256 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Jaramillo-Lambert A, Fuchsman AS, Fabritius AS, Smith HE, Golden A.
Rapid and Efficient Identification of Caenorhabditis elegans Legacy Mutations Using Hawaiian SNP-Based Mapping and Whole-Genome Sequencing.
G3 (Bethesda) 2015 5(5) 1007-19 
[ PubMed ID = 25740937 ] [ RRC reference ]

Smolikov S, Schild-Prüfert K, Colaiácovo MP.
A yeast two-hybrid screen for SYP-3 interactors identifies SYP-4, a component required for synaptonemal complex assembly and chiasma formation in Caenorhabditis elegans meiosis.
PLoS Genet 2009 5(10) e1000669 
[ PubMed ID = 19798442 ] [ RRC reference ]