Mutants (Isolated)

tm2713

Allele Nametm2713
Sequence NameH27M09.3
CGC Namesyp-4
Worm BaseAllele Name tm2713
CGC Name syp-4
Sequence H27M09.3
Phenotypelethal or sterile. Dr. M.P. Colaiacovo: PLoS Genetics 5, 10, e1000669 (2009).
Mutation site5648/5649-5861/5862 (213 bp deletion)
ChromosomeI
Putative gene structurejoin(5521..5586, 5632..5728, 5775..5943, 6014..6297, 6353..6558, 6620..7199, 7246..7389, 7436..7707)
Map position1.39
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:AATGTCGTTTCCGACGCTAC,ExtRev:TCTCCCGCTGATGTACCCTT,IntFwd:CTGCGATGCCATGAGGTATT,IntRev:CGCTGATGTACCCTTGCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jaramillo-Lambert A, Fuchsman AS, Fabritius AS, Smith HE, Golden A.
Rapid and Efficient Identification of Caenorhabditis elegans Legacy Mutations Using Hawaiian SNP-Based Mapping and Whole-Genome Sequencing.
G3 (Bethesda) 2015 5(5) 1007-19 
[ PubMed ID = 25740937 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Smolikov S, Schild-Prüfert K, Colaiácovo MP.
A yeast two-hybrid screen for SYP-3 interactors identifies SYP-4, a component required for synaptonemal complex assembly and chiasma formation in Caenorhabditis elegans meiosis.
PLoS Genet 2009 5(10) e1000669 
[ PubMed ID = 19798442 ] [ RRC reference ]