Mutants (Isolated)

tm2700

Allele Nametm2700
Sequence NameC04F5.1
CGC Namesid-1
Worm BaseAllele Name tm2700
CGC Name sid-1
Sequence C04F5.1
Phenotypehomozygous viable
Mutation site30587/30588-31187/31188 (600 bp deletion)
ChromosomeV
Putative gene structurejoin(30598..30641, 30699..31078, 31122..31399, 32465..33026, 34228..34614, 35949..36451, 37046..37222)
Map position-2.49
Balancer
Map position of balancer
Sequence of primersExtRev:CGTACATTCGCCGGCACAGT,IntFwd:CGACGTTAAACACATCTCAC,IntRev:CGCCGGCACAGTTATCAGAT,ExtFwd:CAGTGGCTTCACCTGTCTTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kage-Nakadai E, Imae R, Suehiro Y, Yoshina S, Hori S, Mitani S.
A conditional knockout toolkit for Caenorhabditis elegans based on the Cre/loxP recombination.
PLoS One 2014 9(12) e114680 
[ PubMed ID = 25474529 ] [ RRC reference ]