Mutants (Isolated)

tm2691

Allele Nametm2691
Allele TypeNormal
Sequence NameT01E8.4
Gene Namemec-15
Worm BaseAllele Name tm2691
Gene Name mec-15
Sequence T01E8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. W. Vermeulen: not sensitive to UV-irradiation.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 31422/31423-31774/31775 (352 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(29245..29332, 29775..29854, 30179..30265, 30311..30436, 30973..31650, 31699..31860))
Map position2.31
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCTTGTGATCAGCGACTAC,ExtRev:GGAGCTCATATCCCTTCCTT,IntFwd:CAGCGACCCGTTTCGCAAAT,IntRev:CCCTTCCTTCGGAGCTCCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sun Y, Hu Z, Goeb Y, Dreier L.
The F-box protein MEC-15 (FBXW9) promotes synaptic transmission in GABAergic motor neurons in C. elegans.
PLoS One 2013 8(3) e59132 
[ PubMed ID = 23527112 ] [ RRC reference ]

Chen CH, Lee A, Liao CP, Liu YW, Pan CL.
RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly.
Proc Natl Acad Sci U S A 2014 111(46) 16568-73 
[ PubMed ID = 25359212 ] [ RRC reference ]

Bounoutas A, Zheng Q, Nonet ML, Chalfie M.
mec-15 encodes an F-box protein required for touch receptor neuron mechanosensation, synapse formation and development.
Genetics 2009 183(2) 607-17, 1SI-4SI 
[ PubMed ID = 19652181 ] [ RRC reference ]