| Allele Name | tm2691 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T01E8.4 |
| Gene Name | mec-15 |
| Worm Base | Allele Name |
tm2691
|
| Gene Name |
mec-15
|
| Sequence |
T01E8.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. W. Vermeulen: not sensitive to UV-irradiation. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 31422/31423-31774/31775 (352 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(29245..29332, 29775..29854, 30179..30265, 30311..30436, 30973..31650, 31699..31860)) |
| Map position | 2.31 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGCTTGTGATCAGCGACTAC,ExtRev:GGAGCTCATATCCCTTCCTT,IntFwd:CAGCGACCCGTTTCGCAAAT,IntRev:CCCTTCCTTCGGAGCTCCTT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Chen CH, Lee A, Liao CP, Liu YW, Pan CL. RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly. Proc Natl Acad Sci U S A 2014 111(46) 16568-73
[ PubMed ID = 25359212 ]
[ RRC reference ]
|
Sun Y, Hu Z, Goeb Y, Dreier L. The F-box protein MEC-15 (FBXW9) promotes synaptic transmission in GABAergic motor neurons in C. elegans. PLoS One 2013 8(3) e59132
[ PubMed ID = 23527112 ]
[ RRC reference ]
|
Bounoutas A, Zheng Q, Nonet ML, Chalfie M. mec-15 encodes an F-box protein required for touch receptor neuron mechanosensation, synapse formation and development. Genetics 2009 183(2) 607-17, 1SI-4SI
[ PubMed ID = 19652181 ]
[ RRC reference ]
|
|