Home > Mutants (Isolated) > tm2691

Mutants (Isolated)

Allele Name		tm2691
Allele Type		Normal
Sequence Name		T01E8.4
Gene Name		mec-15
Worm Base	Allele Name	tm2691
	Gene Name	mec-15
	Sequence	T01E8.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. W. Vermeulen: not sensitive to UV-irradiation.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		31422/31423-31774/31775 (352 bp deletion)
Chromosome		II
Putative gene structure		complement(join(29245..29332, 29775..29854, 30179..30265, 30311..30436, 30973..31650, 31699..31860))
Map position		2.31
Balancer
Map position of balancer
Sequence of primers		ExtFwd:AGCTTGTGATCAGCGACTAC,ExtRev:GGAGCTCATATCCCTTCCTT,IntFwd:CAGCGACCCGTTTCGCAAAT,IntRev:CCCTTCCTTCGGAGCTCCTT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Sun Y, Hu Z, Goeb Y, Dreier L. The F-box protein MEC-15 (FBXW9) promotes synaptic transmission in GABAergic motor neurons in C. elegans. PLoS One 2013 8(3) e59132  [ PubMed ID = 23527112 ] [ RRC reference ] Chen CH, Lee A, Liao CP, Liu YW, Pan CL. RHGF-1/PDZ-RhoGEF and retrograde DLK-1 signaling drive neuronal remodeling on microtubule disassembly. Proc Natl Acad Sci U S A 2014 111(46) 16568-73  [ PubMed ID = 25359212 ] [ RRC reference ] Bounoutas A, Zheng Q, Nonet ML, Chalfie M. mec-15 encodes an F-box protein required for touch receptor neuron mechanosensation, synapse formation and development. Genetics 2009 183(2) 607-17, 1SI-4SI  [ PubMed ID = 19652181 ] [ RRC reference ]