分離済み変異体

tm268

Allele Nametm268
BalanceNot Required
OutCrossNot Accepted
Sequence NameC40H5.5
Gene Namettx-3
Worm BaseAllele Name tm268
Gene Name ttx-3
Sequence C40H5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Ohshima (J. Exp. Biol. 206, 2581- 2593, 2003)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33367/33368-35306/35307 (1939 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(29346..29492, 29543..29721, 31095..31256, 31356..31407, 31465..31570, 31878..31948, 32002..32102, 32346..32596, 33843..33961)
Map position6.28
Balancer
Map position of balancer
Sequence of primersExtRev:AGGCGACGAAAAACAAGAGA,ExtFwd:ATGAAGTTGACCCGTTTTGC,IntFwd:CGGGTCAGTGGGTTTCTTAC,IntRev:AAAATAGAAAACCCCCACGG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Boopathi B, Topalidou I, Kelley M, Meadows SM, Funk O, Ailion M, Fay DS.
Pathways that affect anterior morphogenesis in C. elegans embryos.
bioRxiv 2023   
[ PubMed ID = 37163004 ] [ RRC reference ]

Wang W, Bouhours M, Gracheva EO, Liao EH, Xu K, Sengar AS, Xin X, Roder J, Boone C, Richmond JE, Zhen M, Egan SE.
ITSN-1 controls vesicle recycling at the neuromuscular junction and functions in parallel with DAB-1.
Traffic 2008 9(5) 742-54 
[ PubMed ID = 18298590 ] [ RRC reference ]

Yamada Y, Ohshima Y.
Distribution and movement of Caenorhabditis elegans on a thermal gradient.
J Exp Biol 2003 206(Pt 15) 2581-93 
[ PubMed ID = 12819265 ] [ RRC reference ]