Mutants (Isolated)

tm268

Allele Nametm268
Sequence NameC40H5.5
CGC Namettx-3
Worm BaseAllele Name tm268
CGC Name ttx-3
Sequence C40H5.5
Phenotypehomozygous viable. Dr. Y. Ohshima (J. Exp. Biol. 206, 2581- 2593, 2003)
Mutation site33367/33368-35306/35307 (1939 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(29346..29492, 29543..29721, 31095..31256, 31356..31407, 31465..31570, 31878..31948, 32002..32102, 32346..32596, 33843..33961)
Map position6.28
Balancer
Map position of balancer
Sequence of primersExtRev:AGGCGACGAAAAACAAGAGA,ExtFwd:ATGAAGTTGACCCGTTTTGC,IntFwd:CGGGTCAGTGGGTTTCTTAC,IntRev:AAAATAGAAAACCCCCACGG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Yamada Y, Ohshima Y.
Distribution and movement of Caenorhabditis elegans on a thermal gradient.
J. Exp. Biol. 2003 206(Pt 15) 2581-93 
[ PubMed ID = 12819265 ] [ RRC reference ]

Wang W, Bouhours M, Gracheva EO, Liao EH, Xu K, Sengar AS, Xin X, Roder J, Boone C, Richmond JE, Zhen M, Egan SE.
ITSN-1 controls vesicle recycling at the neuromuscular junction and functions in parallel with DAB-1.
Traffic 2008 9(5) 742-54 
[ PubMed ID = 18298590 ] [ RRC reference ]