| Allele Name | tm2669 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | AH6.1 |
| Gene Name | gcy-1 |
| Worm Base | Allele Name |
tm2669
|
| Gene Name |
gcy-1
|
| Sequence |
AH6.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. O. Hobert: potassium chemotaxis defective. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2666/2667-3349/3350 (683 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(4270..4368, 3996..4126, 3469..3711, 3195..3424, 2999..3151, 2851..2948, 2672..2797, 2483..2621, 2288..2418, 1579..2235, 1226..1526, 1002..1179, 544..951, 397..500, 102..337, Z48007.1:14051..14230)) |
| Map position | 1.48 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GTTACTCCACTGTGCCCAGT,IntFwd:GATCTCCGACTTGCCCCTTT,ExtRev:ATCGGACCACCATGCGCACA,IntRev:ATGTCATACGATTTCCGCAC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O. Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans. Genetics 2013 194(4) 885-901
[ PubMed ID = 23695300 ]
[ RRC reference ]
|
Murayama T, Takayama J, Fujiwara M, Maruyama IN. Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans. Curr Biol 2013 23(11) 1007-12
[ PubMed ID = 23664973 ]
[ RRC reference ]
|
Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M. Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans. PLoS Genet 2011 7(10) e1002335
[ PubMed ID = 22022287 ]
[ RRC reference ]
|
Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N. Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans. Proc Natl Acad Sci U S A 2011 108(1) 254-9
[ PubMed ID = 21173231 ]
[ RRC reference ]
|
Ortiz CO, Faumont S, Takayama J, Ahmed HK, Goldsmith AD, Pocock R, McCormick KE, Kunimoto H, Iino Y, Lockery S, Hobert O. Lateralized gustatory behavior of C. elegans is controlled by specific receptor-type guanylyl cyclases. Curr Biol 2009 19(12) 996-1004
[ PubMed ID = 19523832 ]
[ RRC reference ]
|
|