Mutants (Isolated)

tm2669

Allele Nametm2669
Sequence NameAH6.1
CGC Namegcy-1
Worm BaseAllele Name tm2669
CGC Name gcy-1
Sequence AH6.1
Phenotypehomozygous viable. Dr. O. Hobert: potassium chemotaxis defective.
Mutation site2666/2667-3349/3350 (683 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(4270..4368, 3996..4126, 3469..3711, 3195..3424, 2999..3151, 2851..2948, 2672..2797, 2483..2621, 2288..2418, 1579..2235, 1226..1526, 1002..1179, 544..951, 397..500, 102..337, Z48007.1:14051..14230))
Map position1.48
Balancer
Map position of balancer
Sequence of primersExtFwd:GTTACTCCACTGTGCCCAGT,IntFwd:GATCTCCGACTTGCCCCTTT,ExtRev:ATCGGACCACCATGCGCACA,IntRev:ATGTCATACGATTTCCGCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9 
[ PubMed ID = 21173231 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335 
[ PubMed ID = 22022287 ] [ RRC reference ]

Smith HK, Luo L, O'Halloran D, Guo D, Huang XY, Samuel AD, Hobert O.
Defining specificity determinants of cGMP mediated gustatory sensory transduction in Caenorhabditis elegans.
Genetics 2013 194(4) 885-901 
[ PubMed ID = 23695300 ] [ RRC reference ]

Murayama T, Takayama J, Fujiwara M, Maruyama IN.
Environmental alkalinity sensing mediated by the transmembrane guanylyl cyclase GCY-14 in C. elegans.
Curr Biol 2013 23(11) 1007-12 
[ PubMed ID = 23664973 ] [ RRC reference ]

Ortiz CO, Faumont S, Takayama J, Ahmed HK, Goldsmith AD, Pocock R, McCormick KE, Kunimoto H, Iino Y, Lockery S, Hobert O.
Lateralized gustatory behavior of C. elegans is controlled by specific receptor-type guanylyl cyclases.
Curr Biol 2009 19(12) 996-1004 
[ PubMed ID = 19523832 ] [ RRC reference ]