| Allele Name | tm2652 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F54F2.5 |
| Gene Name | ztf-1 |
| Worm Base | Allele Name |
tm2652
|
| Gene Name |
ztf-1
|
| Sequence |
F54F2.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 3319/3320-TC-3911/3912 (592 bp deletion + 2 bp insertion) |
| Chromosome | III |
| Putative gene structure | complement(join(26..99, 156..260, 328..504, 915..987, 1755..1919, 2429..2619, 2677..2757, 2806..2855, 3329..3454, 3600..3691, 3740..3853, 4164..4248, 4298..4431, 4817..5098)) |
| Map position | -0.05 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:TCTTACCTGATGGACGATAC,ExtRev:CCCGTAATGAAATTCGGGCT,IntFwd:TTCGTGTACATCAGTGCGAT,ExtFwd:GTATCGCCTGCTTGTACACT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ]
[ RRC reference ]
|
Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ]
[ RRC reference ]
|
Booth LN, Shi C, Tantilert C, Yeo RW, Miklas JW, Hebestreit K, Hollenhorst CN, Maures TJ, Buckley MT, Murphy CT, Brunet A.
Males induce premature demise of the opposite sex by multifaceted strategies.
Nat Aging 2022 2(9) 809-823
[ PubMed ID = 37118502 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.