分離済み変異体

tm2652

Allele Nametm2652
BalanceNot Required
OutCrossNot Accepted
Sequence NameF54F2.5
Gene Nameztf-1
Worm BaseAllele Name tm2652
Gene Name ztf-1
Sequence F54F2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3319/3320-TC-3911/3912 (592 bp deletion + 2 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(26..99, 156..260, 328..504, 915..987, 1755..1919, 2429..2619, 2677..2757, 2806..2855, 3329..3454, 3600..3691, 3740..3853, 4164..4248, 4298..4431, 4817..5098))
Map position-0.05
Balancer
Map position of balancer
Sequence of primersIntRev:TCTTACCTGATGGACGATAC,ExtRev:CCCGTAATGAAATTCGGGCT,IntFwd:TTCGTGTACATCAGTGCGAT,ExtFwd:GTATCGCCTGCTTGTACACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Booth LN, Shi C, Tantilert C, Yeo RW, Miklas JW, Hebestreit K, Hollenhorst CN, Maures TJ, Buckley MT, Murphy CT, Brunet A.
Males induce premature demise of the opposite sex by multifaceted strategies.
Nat Aging 2022 2(9) 809-823 
[ PubMed ID = 37118502 ] [ RRC reference ]