Mutants (Isolated)

tm2647

Allele Nametm2647
Sequence NameF16D3.7
CGC Nameser-5
Worm BaseAllele Name tm2647
CGC Name ser-5
Sequence F16D3.7
Phenotypehomozygous viable. Dr. K. Ashrafi: increased Nile Red staining.
Mutation site[T19A6] 611/612-[T19A6] 830/831 (219 bp deletion)
ChromosomeI
Putative gene structurejoin(32458..32583, AL021571.1:140..457, AL021571.1:503..676, AL021571.1:729..1661)
Map position2.77
Balancer
Map position of balancer
Sequence of primersExtFwd:GCTGGGATAAGTACGGGCAA,IntFwd:GCTTCGAATAATTCTCCGTG,ExtRev:GCCTCCTTTTGGATCGAACT,IntRev:CAAACGATCGGTGCCTTGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stern S, Kirst C, Bargmann CI.
Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development.
Cell 2017 171(7) 1649-1662.e10 
[ PubMed ID = 29198526 ] [ RRC reference ]

Govorunova EG, Moussaif M, Kullyev A, Nguyen KC, McDonald TV, Hall DH, Sze JY.
A homolog of FHM2 is involved in modulation of excitatory neurotransmission by serotonin in C. elegans.
PLoS One 2010 5(4) e10368 
[ PubMed ID = 20442779 ] [ RRC reference ]

Rangaraju S, Solis GM, Thompson RC, Gomez-Amaro RL, Kurian L, Encalada SE, Niculescu AB 3rd, Salomon DR, Petrascheck M.
Suppression of transcriptional drift extends C. elegans lifespan by postponing the onset of mortality.
Elife 2015 4 e08833 
[ PubMed ID = 26623667 ] [ RRC reference ]

Guo M, Wu TH, Song YX, Ge MH, Su CM, Niu WP, Li LL, Xu ZJ, Ge CL, Al-Mhanawi MT, Wu SP, Wu ZX.
Reciprocal inhibition between sensory ASH and ASI neurons modulates nociception and avoidance in Caenorhabditis elegans.
Nat Commun 2015 6 5655 
[ PubMed ID = 25585042 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Harris G, Korchnak A, Summers P, Hapiak V, Law WJ, Stein AM, Komuniecki P, Komuniecki R.
Dissecting the serotonergic food signal stimulating sensory-mediated aversive behavior in C. elegans.
PLoS One 2011 6(7) e21897 
[ PubMed ID = 21814562 ] [ RRC reference ]

Harris G, Mills H, Wragg R, Hapiak V, Castelletto M, Korchnak A, Komuniecki RW.
The monoaminergic modulation of sensory-mediated aversive responses in Caenorhabditis elegans requires glutamatergic/peptidergic cotransmission.
J Neurosci 2010 30(23) 7889-99 
[ PubMed ID = 20534837 ] [ RRC reference ]

Harris GP, Hapiak VM, Wragg RT, Miller SB, Hughes LJ, Hobson RJ, Steven R, Bamber B, Komuniecki RW.
Three distinct amine receptors operating at different levels within the locomotory circuit are each essential for the serotonergic modulation of chemosensation in Caenorhabditis elegans.
J Neurosci 2009 29(5) 1446-56 
[ PubMed ID = 19193891 ] [ RRC reference ]

Hapiak VM, Hobson RJ, Hughes L, Smith K, Harris G, Condon C, Komuniecki P, Komuniecki RW.
Dual excitatory and inhibitory serotonergic inputs modulate egg laying in Caenorhabditis elegans.
Genetics 2009 181(1) 153-63 
[ PubMed ID = 19001289 ] [ RRC reference ]