Mutants (Isolated)

tm2626

Allele Nametm2626
Allele TypeNormal
Sequence NameY105E8A.1
Gene NameY105E8A.1
Worm BaseAllele Name tm2626
Gene Name Y105E8A.1
Sequence Y105E8A.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8910-GAAAGGT-10529/10530 (1620 bp deletion + 7 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(8452..8781, 8882..8953, 9025..9099, 10412..10645))
Map position24.42
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGGCTTCGCTAGAGTTATC,IntFwd:CTGCCTTCTTCTCATCGGAC,IntRev:CCACTGCAAACCCGGAGACT,ExtRev:ACGTAGCAAGTGCCACTGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]