Mutants (Isolated)

tm2626

Allele Nametm2626
Sequence NameY105E8A.1
CGC NameY105E8A.1
Worm BaseAllele Name tm2626
CGC Name Y105E8A.1
Sequence Y105E8A.1
Phenotypehomozygous viable
Mutation site8910-GAAAGGT-10529/10530 (1620 bp deletion + 7 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(8452..8781, 8882..8953, 9025..9099, 10412..10645))
Map position24.42
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGGCTTCGCTAGAGTTATC,IntFwd:CTGCCTTCTTCTCATCGGAC,IntRev:CCACTGCAAACCCGGAGACT,ExtRev:ACGTAGCAAGTGCCACTGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]