Home > Mutants (Isolated) > tm2590

Mutants (Isolated)

Allele Name		tm2590
Allele Type		Normal
Sequence Name		Y40B10A.8
Gene Name		nhr-86
Worm Base	Allele Name	tm2590
	Gene Name	nhr-86
	Sequence	Y40B10A.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		29886/29887-GG-30058/30059 (172 bp deletion + 2 bp insertion)
Chromosome		V
Putative gene structure		complement(join(27938..28042, 28934..29213, 30027..30211, 31544..31669, 32359..32675, 33282..33492))
Map position		-16.08
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GCATGGCCGAGCTTTTACGT,IntFwd:TCGGCCACCAAACGATAACT,ExtRev:CCCAGAGGCGTGTTTTAAAG,IntRev:CCGCAACTTCTACACGCCGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Peterson ND, Tse SY, Huang QJ, Wani KA, Schiffer CA, Pukkila-Worley R. Non-canonical pattern recognition of a pathogen-derived metabolite by a nuclear hormone receptor identifies virulent bacteria in C. elegans. Immunity 2023 56(4) 768-782.e9  [ PubMed ID = 36804958 ] [ RRC reference ] Peterson ND, Cheesman HK, Liu P, Anderson SM, Foster KJ, Chhaya R, Perrat P, Thekkiniath J, Yang Q, Haynes CM, Pukkila-Worley R. The nuclear hormone receptor NHR-86 controls anti-pathogen responses in C. elegans. PLoS Genet 2019 15(1) e1007935  [ PubMed ID = 30668573 ] [ RRC reference ] Arda HE, Taubert S, MacNeil LT, Conine CC, Tsuda B, Van Gilst M, Sequerra R, Doucette-Stamm L, Yamamoto KR, Walhout AJ. Functional modularity of nuclear hormone receptors in a Caenorhabditis elegans metabolic gene regulatory network. Mol Syst Biol 2010 6 367  [ PubMed ID = 20461074 ] [ RRC reference ]