Mutants (Isolated)

tm259

Allele Nametm259
Sequence NameZK1193.5
CGC Namedve-1
Worm BaseAllele Name tm259
CGC Name dve-1
Sequence ZK1193.5
Phenotypelethal or sterile?. Dr. P. Sengputa: normal dye filling. Dr. W.B. Derry: non-Mendelian inheritance. Deletion is unstable extrachromosomal? Dr. C. Yang: normal cell death phenotype.
Mutation site21397/21398-22381/22382 (984 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (20302..20363, 20412..20627, 20679..20737, 21086..21144, 21284..21355, 21406..21575, 22125..22272, 22578..22877, 22928..23090, 25459..25568, 25621..25735, 26430..26556, 27198..27378))
Map position-19.89
Balancer
Map position of balancer
Sequence of primersExtFwd:GGGGTACACCAGTATGACGG,IntFwd:ATTTTATACGAAAACCTTCTGC,IntRev:CGTTCTCTAAGTGCCCTCCA,ExtRev:GTTGATGCCCGGATAAGAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Haynes CM, Petrova K, Benedetti C, Yang Y, Ron D.
ClpP mediates activation of a mitochondrial unfolded protein response in C. elegans.
Dev. Cell 2007 13(4) 467-80 
[ PubMed ID = 17925224 ] [ RRC reference ]