Mutants (Isolated)

tm258

Allele Nametm258
Sequence NameK12H4.1
CGC Nameceh-26
Worm BaseAllele Name tm258
CGC Name ceh-26
Sequence K12H4.1
Phenotypelethal or sterile. Dr. M. Barr: male mating behavior normal, pkd-2::gfp expression normal.
Mutation site26659/26660-27563/27564 (904 bp deletion)
ChromosomeIII
Putative gene structurejoin(25352..25410, 25460..25610, 26128..26274, 26341..26536, 26913..27097, 27145..27367, 27529..28000, 28417..28561, 28608..28715, 28963..29037)
Map position-0.44
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:GAAGTCAACGGAAGGGATGA,IntRev:GCACATTTTGAAATGGGGACT,ExtRev:AAATCGGAGGCACAGAAAGT,IntFwd:TGAGACGGAAACGATGACAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kage-Nakadai E, Ohta A, Ujisawa T, Sun S, Nishikawa Y, Kuhara A, Mitani S.
Caenorhabditis elegans homologue of Prox1/Prospero is expressed in the glia and is required for sensory behavior and cold tolerance.
Genes Cells. 2016 21(9) 936-48. 
[ PubMed ID = -1 ] [ RRC reference ]

Wallace SW, Singhvi A, Liang Y, Lu Y, Shaham S.
PROS-1/Prospero Is a Major Regulator of the Glia-Specific Secretome Controlling Sensory-Neuron Shape and Function in C. elegans.
Cell Rep 2016 15(3) 550-562 
[ PubMed ID = 27068465 ] [ RRC reference ]