Mutants (Isolated)

tm2573

Allele Nametm2573
Sequence NameY75B12B.5
CGC Namecyn-3
Worm BaseAllele Name tm2573
CGC Name cyn-3
Sequence Y75B12B.5
Phenotypehomozygous viable
Mutation site6812/6813-ACGACG-7043/7044 (231 bp deletion + 6 bp insertion)
ChromosomeV
Putative gene structurejoin(6757..6825, 6876..7127, 7438..7638)
Map position7.55
Balancer
Map position of balancer
Sequence of primersIntRev:TGCCTTGAGTTGTCCACAGT,IntFwd:TGACCCCGCCCACAAATCGA,ExtRev:CAATCGGGGATAACTGAGGT,ExtFwd:GCACGCTCTGCTGATGAAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]