Mutants (Isolated)

tm2531

Allele Nametm2531
Allele TypeNormal
Sequence NameY26E6A.1
Gene Nameekl-5
Worm BaseAllele Name tm2531
Gene Name ekl-5
Sequence Y26E6A.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14158/14159-AAAAAAAATCATTCGGGAAAAAATAATCACCATAATTTTGCATGCTCCTTT-14847/14848 (689 bp deletion + 51 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(13206..13571, 13624..13776, 13855..14061, 14129..14229, 14280..14528, 14753..15026))
Map position15.24
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTTCGATGGCTGCGATACT,ExtRev:GTATCACACCGTGAAAGCAC,IntFwd:GGCTGCGATACTTCACCAAA,IntRev:CGCGATCAGGCTGCCGATAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV.
The Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway.
Genetics 2008 178(3) 1431-43 
[ PubMed ID = 18245826 ] [ RRC reference ]