Mutants (Isolated)

tm251

Allele Nametm251
Sequence NameC37E2.4
CGC Nameceh-36
Worm BaseAllele Name tm251
CGC Name ceh-36
Sequence C37E2.4
PhenotypeLethal or sterile. Dr. O. Hobert: no defect in ASE development. Dr. T. Buerglin: complicated rearrangement.
Mutation site15183/15184-16160/16161 (977 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (13868..13998, 14611..14755, 14839..14947, 15000..15079, 15234..15399, 15812..15954))
Map position16.13
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CATTCCCTTCTGTATGTTCC,IntFwd:GAATTTAGGCGTATGTAACCAT,ExtFwd:ATGACTGATAATGAAAGCATCC,ExtRev:CATAACATGAGTCATACGTGG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Sarin S, O'Meara MM, Flowers EB, Antonio C, Poole RJ, Didiano D, Johnston RJ Jr, Chang S, Narula S, Hobert O.
Genetic screens for Caenorhabditis elegans mutants defective in left/right asymmetric neuronal fate specification.
Genetics 2007 176(4) 2109-30 
[ PubMed ID = 17717195 ] [ RRC reference ]