Mutants (Isolated)

tm2508

Allele Nametm2508
Sequence NameT08A9.1
CGC Nameatg-11
Worm BaseAllele Name tm2508
CGC Name atg-11
Sequence T08A9.1
Phenotypehomozygous viable
Mutation site25559/25560-26107/26108 (548 bp deletion)
ChromosomeX
Putative gene structurejoin(23074..23109, 23158..23229, 23279..23458, 23506..23646, 23749..24214, 24270..24948, 24996..25109, 25160..25286, 25336..26028, 26075..26934, 26986..27119, 27533..27782, 27830..27973, 28024..28120)
Map position-1.75
Balancer
Map position of balancer
Sequence of primersIntFwd:GTATATACGAGGCTCCAATC,ExtFwd:AACCAGCGTCTTTGATGACT,IntRev:GTGCTTTCTCATGAGCGATG,ExtRev:AGTACGGATCGTTACGAAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zhang G, Lin L, Qi D, Zhang H.
The composition of a protein aggregate modulates the specificity and efficiency of its autophagic degradation.
Autophagy 2017 13(9) 1487-1495 
[ PubMed ID = 28806108 ] [ RRC reference ]

Kosztelnik M, Kurucz A, Papp D, Jones E, Sigmond T, Barna J, Traka MH, Lorincz T, Szarka A, Banhegyi G, Vellai T, Korcsmaros T, Kapuy O.
Suppression of AMPK/aak-2 by NRF2/SKN-1 down-regulates autophagy during prolonged oxidative stress.
FASEB J. 2019 33(2) 2372-2387 
[ PubMed ID = 30277819 ] [ RRC reference ]

Buddell T, Friedman V, Drozd CJ, Quinn CC.
An autism-causing calcium channel variant functions with selective autophagy to alter axon targeting and behavior.
PLoS Genet. 2019 15(12) e1008488 
[ PubMed ID = 31805042 ] [ RRC reference ]

Lin L, Yang P, Huang X, Zhang H, Lu Q, Zhang H.
The scaffold protein EPG-7 links cargo-receptor complexes with the autophagic assembly machinery.
J. Cell Biol. 2013 201(1) 113-29 
[ PubMed ID = 23530068 ] [ RRC reference ]

Zhang P, Zhang H.
Autophagy modulates miRNA-mediated gene silencing and selectively degrades AIN-1/GW182 in C. elegans.
EMBO Rep. 2013 14(6) 568-76 
[ PubMed ID = 23619095 ] [ RRC reference ]

Wu F, Watanabe Y, Guo XY, Qi X, Wang P, Zhao HY, Wang Z, Fujioka Y, Zhang H, Ren JQ, Fang TC, Shen YX, Feng W, Hu JJ, Noda NN, Zhang H.
Structural Basis of the Differential Function of the Two C. elegans Atg8 Homologs, LGG-1 and LGG-2, in Autophagy.
Mol. Cell 2015 60(6) 914-29 
[ PubMed ID = 26687600 ] [ RRC reference ]

Sato M, Sato K, Tomura K, Kosako H, Sato K.
The autophagy receptor ALLO-1 and the IKKE-1 kinase control clearance of paternal mitochondria in Caenorhabditis elegans.
Nat. Cell Biol. 2018 20(1) 81-91 
[ PubMed ID = 29255173 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev. Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev. Biol. 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]