Mutants (Isolated)

tm2484

Allele Nametm2484
Sequence NameC06H5.7
CGC Namedcar-1
Worm BaseAllele Name tm2484
CGC Name dcar-1
Sequence C06H5.7
Phenotypehomozygous viable
Mutation site34337/34338-34561/34562 (224 bp deletion)
ChromosomeV
Putative gene structurejoin(30190..30258, 32442..32558, 32605..32732, 34092..34256, 34308..34643, 34836..34980, 36718..36948)
Map position13.33
Balancer
Map position of balancer
Sequence of primersIntRev:ACCAAGCCAATGCACCTTAA,IntFwd:CACAATGCGGAGATGTGTCA,ExtRev:CGGGTTCAGTACCAAGCCAA,ExtFwd:TGGTCAGCAATGGTGTCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Vérièpe J, Fossouo L, Parker JA.
Neurodegeneration in C. elegans models of ALS requires TIR-1/Sarm1 immune pathway activation in neurons.
Nat Commun 2015 6 7319 
[ PubMed ID = 26059317 ] [ RRC reference ]

Aoki R, Yagami T, Sasakura H, Ogura K, Kajihara Y, Ibi M, Miyamae T, Nakamura F, Asakura T, Kanai Y, Misu Y, Iino Y, Ezcurra M, Schafer WR, Mori I, Goshima Y.
A seven-transmembrane receptor that mediates avoidance response to dihydrocaffeic acid, a water-soluble repellent in Caenorhabditis elegans.
J. Neurosci. 2011 31(46) 16603-10 
[ PubMed ID = 22090488 ] [ RRC reference ]

Zugasti O, Bose N, Squiban B, Belougne J, Kurz CL, Schroeder FC, Pujol N, Ewbank JJ.
Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans.
Nat. Immunol. 2014 15(9) 833-8 
[ PubMed ID = 25086774 ] [ RRC reference ]