Home > Mutants (Isolated) > tm2484

Mutants (Isolated)

Allele Name		tm2484
Sequence Name		C06H5.7
CGC Name		dcar-1
Worm Base	Allele Name	tm2484
	CGC Name	dcar-1
	Sequence	C06H5.7
Phenotype		homozygous viable
Mutation site		34337/34338-34561/34562 (224 bp deletion)
Chromosome		V
Putative gene structure		join(30190..30258, 32442..32558, 32605..32732, 34092..34256, 34308..34643, 34836..34980, 36718..36948)
Map position		13.33
Balancer
Map position of balancer
Sequence of primers		IntRev:ACCAAGCCAATGCACCTTAA,IntFwd:CACAATGCGGAGATGTGTCA,ExtRev:CGGGTTCAGTACCAAGCCAA,ExtFwd:TGGTCAGCAATGGTGTCCTA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Vérièpe J, Fossouo L, Parker JA. Neurodegeneration in C. elegans models of ALS requires TIR-1/Sarm1 immune pathway activation in neurons. Nat Commun 2015 6 7319  [ PubMed ID = 26059317 ] [ RRC reference ] Aoki R, Yagami T, Sasakura H, Ogura K, Kajihara Y, Ibi M, Miyamae T, Nakamura F, Asakura T, Kanai Y, Misu Y, Iino Y, Ezcurra M, Schafer WR, Mori I, Goshima Y. A seven-transmembrane receptor that mediates avoidance response to dihydrocaffeic acid, a water-soluble repellent in Caenorhabditis elegans. J. Neurosci. 2011 31(46) 16603-10  [ PubMed ID = 22090488 ] [ RRC reference ] Zugasti O, Bose N, Squiban B, Belougne J, Kurz CL, Schroeder FC, Pujol N, Ewbank JJ. Activation of a G protein-coupled receptor by its endogenous ligand triggers the innate immune response of Caenorhabditis elegans. Nat. Immunol. 2014 15(9) 833-8  [ PubMed ID = 25086774 ] [ RRC reference ]