分離済み変異体

tm2482

Allele Name

tm2482

Allele Type

通常株

Sequence Name

R74.3

Gene Name

xbp-1

Worm Base

Allele Name

tm2482

Gene Name

xbp-1

Sequence

R74.3

Phenotype

homozygous viable

Mutation site

10355/10356-10557/10558 (202 bp deletion)

Chromosome

III

Putative gene structure

join(10193..10372, 10423..10901, 10956..11091)

Map position

-3.7

Balancer

Map position of balancer

Sequence of primers

IntRev:CATACGACGGAGTTGGTTGC,IntFwd:TTATGTGCTCCCAGCACGCC,ExtFwd:GCCCCATATTCGCTACACTG,ExtRev:CATGTGGTTGCATAGAATCG

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Li X, Li J, Zhu D, Zhang N, Hao X, Zhang W, Zhang Q, Liu Y, Wu X, Tian Y.
Protein disulfide isomerase PDI-6 regulates Wnt secretion to coordinate inter-tissue UPR^mt activation and lifespan extension in C. elegans.
Cell Rep 2022 39(10) 110931
[ PubMed ID = 35675782 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704
[ PubMed ID = 32986702 ] [ RRC reference ]

Tillman EJ, Richardson CE, Cattie DJ, Reddy KC, Lehrbach NJ, Droste R, Ruvkun G, Kim DH.
Endoplasmic Reticulum Homeostasis Is Modulated by the Forkhead Transcription Factor FKH-9 During Infection of Caenorhabditis elegans.
Genetics 2018 210(4) 1329-1337
[ PubMed ID = 30287474 ] [ RRC reference ]

Cattie DJ, Richardson CE, Reddy KC, Ness-Cohn EM, Droste R, Thompson MK, Gilbert WV, Kim DH.
Mutations in Nonessential eIF3k and eIF3l Genes Confer Lifespan Extension and Enhanced Resistance to ER Stress in Caenorhabditis elegans.
PLoS Genet 2016 12(9) e1006326
[ PubMed ID = 27690135 ] [ RRC reference ]

Truttmann MC, Cruz VE, Guo X, Engert C, Schwartz TU, Ploegh HL.
The Caenorhabditis elegans Protein FIC-1 Is an AMPylase That Covalently Modifies Heat-Shock 70 Family Proteins, Translation Elongation Factors and Histones.
PLoS Genet 2016 12(5) e1006023
[ PubMed ID = 27138431 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5
[ PubMed ID = 20182512 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr Biol 2013 23(24) 2540-5
[ PubMed ID = 24316205 ] [ RRC reference ]

Asakura T, Ogura K, Goshima Y.
IRE-1/XBP-1 pathway of the unfolded protein response is required for properly localizing neuronal UNC-6/Netrin for axon guidance in C. elegans.
Genes Cells 2015 20(3) 153-9
[ PubMed ID = 25469499 ] [ RRC reference ]

Wei X, Howell AS, Dong X, Taylor CA, Cooper RC, Zhang J, Zou W, Sherwood DR, Shen K.
The unfolded protein response is required for dendrite morphogenesis.
Elife 2015 4 e06963
[ PubMed ID = 26052671 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet 2014 10(10) e1004747
[ PubMed ID = 25340700 ] [ RRC reference ]

Richardson CE, Kinkel S, Kim DH.
Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity.
PLoS Genet 2011 7(11) e1002391
[ PubMed ID = 22125500 ] [ RRC reference ]