Mutants (Isolated)

tm2482

Allele Nametm2482
Sequence NameR74.3
CGC Namexbp-1
Worm BaseAllele Name tm2482
CGC Name xbp-1
Sequence R74.3
Phenotypehomozygous viable
Mutation site10355/10356-10557/10558 (202 bp deletion)
ChromosomeIII
Putative gene structurejoin(10193..10372, 10423..10901, 10956..11091)
Map position-3.7
Balancer
Map position of balancer
Sequence of primersIntRev:CATACGACGGAGTTGGTTGC,IntFwd:TTATGTGCTCCCAGCACGCC,ExtFwd:GCCCCATATTCGCTACACTG,ExtRev:CATGTGGTTGCATAGAATCG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wei X, Howell AS, Dong X, Taylor CA, Cooper RC, Zhang J, Zou W, Sherwood DR, Shen K.
The unfolded protein response is required for dendrite morphogenesis.
Elife 2015 4 e06963 
[ PubMed ID = 26052671 ] [ RRC reference ]

Asakura T, Ogura K, Goshima Y.
IRE-1/XBP-1 pathway of the unfolded protein response is required for properly localizing neuronal UNC-6/Netrin for axon guidance in C. elegans.
Genes Cells 2015 20(3) 153-9 
[ PubMed ID = 25469499 ] [ RRC reference ]

Richardson CE, Kinkel S, Kim DH.
Physiological IRE-1-XBP-1 and PEK-1 signaling in Caenorhabditis elegans larval development and immunity.
PLoS Genet. 2011 7(11) e1002391 
[ PubMed ID = 22125500 ] [ RRC reference ]

Richardson CE, Kooistra T, Kim DH.
An essential role for XBP-1 in host protection against immune activation in C. elegans.
Nature 2010 463(7284) 1092-5 
[ PubMed ID = 20182512 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr. Biol. 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet. 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]