Mutants (Isolated)

tm2470

Allele Nametm2470
Sequence NameF52G2.1
CGC Namedcap-2
Worm BaseAllele Name tm2470
CGC Name dcap-2
Sequence F52G2.1
Phenotypehomozygous viable.
Mutation site2682/2683-2980/2981 (298 bp deletion)
ChromosomeIV
Putative gene structurejoin(complement(5941..6084), complement(4410..4841), complement(2762..2938), complement(2382..2713), complement(699..1258), complement(AL021488.1:24886..25574), complement(AL021488.1:23985..24080))
Map position9.47
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTCTCTCGAATCGCCGCAT,ExtRev:CACGAATTCCGAATACCCCA,IntFwd:TCTCGGTGGCTCTGCCTGAT,IntRev:CCATAAGTGAACAGGCGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Boag PR, Atalay A, Robida S, Reinke V, Blackwell TK.
Protection of specific maternal messenger RNAs by the P body protein CGH-1 (Dhh1/RCK) during Caenorhabditis elegans oogenesis.
J. Cell Biol. 2008 182(3) 543-57 
[ PubMed ID = 18695045 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]