| Allele Name | tm2470 |
| Allele Type | 通常株 |
| Sequence Name | F52G2.1 |
| Gene Name | dcap-2 |
| Worm Base | Allele Name |
tm2470
|
| Gene Name |
dcap-2
|
| Sequence |
F52G2.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 2682/2683-2980/2981 (298 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(23348..24080, 24886..25574, 699..1258, 2382..2713, 2762..2938, 4410..4841, 5941..5997)) |
| Map position | 9.47 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AGTCTCTCGAATCGCCGCAT,ExtRev:CACGAATTCCGAATACCCCA,IntFwd:TCTCGGTGGCTCTGCCTGAT,IntRev:CCATAAGTGAACAGGCGACT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Tang NH, Kim KW, Xu S, Blazie SM, Yee BA, Yeo GW, Jin Y, Chisholm AD.
The mRNA Decay Factor CAR-1/LSM14 Regulates Axon Regeneration via Mitochondrial Calcium Dynamics.
Curr Biol 2020 30(5) 865-876.e7
[ PubMed ID = 31983639 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Boag PR, Atalay A, Robida S, Reinke V, Blackwell TK.
Protection of specific maternal messenger RNAs by the P body protein CGH-1 (Dhh1/RCK) during Caenorhabditis elegans oogenesis.
J Cell Biol 2008 182(3) 543-57
[ PubMed ID = 18695045 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.