分離済み変異体

tm2470

Allele Nametm2470
BalanceNot Required
OutCrossNot Accepted
Sequence NameF52G2.1
Gene Namedcap-2
Worm BaseAllele Name tm2470 (x1)
Gene Name dcap-2
Sequence F52G2.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2682/2683-2980/2981 (298 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(23348..24080, 24886..25574, 699..1258, 2382..2713, 2762..2938, 4410..4841, 5941..5997))
Map position9.47
BalancernT1
Map position of balancer
Sequence of primersExtFwd:AGTCTCTCGAATCGCCGCAT,ExtRev:CACGAATTCCGAATACCCCA,IntFwd:TCTCGGTGGCTCTGCCTGAT,IntRev:CCATAAGTGAACAGGCGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tang NH, Kim KW, Xu S, Blazie SM, Yee BA, Yeo GW, Jin Y, Chisholm AD.
The mRNA Decay Factor CAR-1/LSM14 Regulates Axon Regeneration via Mitochondrial Calcium Dynamics.
Curr Biol 2020 30(5) 865-876.e7 
[ PubMed ID = 31983639 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Boag PR, Atalay A, Robida S, Reinke V, Blackwell TK.
Protection of specific maternal messenger RNAs by the P body protein CGH-1 (Dhh1/RCK) during Caenorhabditis elegans oogenesis.
J Cell Biol 2008 182(3) 543-57 
[ PubMed ID = 18695045 ] [ RRC reference ]