Mutants (Isolated)

tm246

Allele Nametm246
Allele TypeBalanced
Sequence NameC44C1.4a
Gene Namevps-45
Worm BaseAllele Name tm246
Gene Name vps-45
Sequence C44C1.4a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" maternal effect larval lethal. Dr. G. Hermann: WT gut granules.Dr. S. L'Hernault: could not recover.Dr. S. Mitani: EMBOR 8, 152 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15824/15825-17002/17003 (1178 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(12890..12941, 13131..13280, 13327..13449, 13801..13907, 13957..14049, 14571..14660, 14708..15203, 15774..15949, 16124..16188, 16236..16434, 16826..16918))
Map position-18.69
Balancerdpy-3 (e27) X
Map position of balancer
Sequence of primersIntRev:TCTCCTGCTCTACTTCTGCT,ExtFwd:ATGGGTGTACTGATCGTGAT,ExtRev:CTAGTACATCACGCATACGG,IntFwd:ATTTGCGTATGCACTGACCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kumagai M, Ando H, Nakai J.
Domain 3a mutation of VPS33A suppresses larval arrest phenotype in the loss of VPS45 in Caenorhabditis elegans.
MicroPubl Biol 2024 2024  
[ PubMed ID = 38585203 ] [ RRC reference ]

Gengyo-Ando K, Tateyama M, Mitani S, Ando H, Nakai J.
A humanized Caenorhabditis elegans model for studying pathogenic mutations in VPS45, a protein essential for membrane trafficking, associated with severe congenital neutropenia.
MicroPubl Biol 2023 2023  
[ PubMed ID = 38089934 ] [ RRC reference ]

Los FC, Kao CY, Smitham J, McDonald KL, Ha C, Peixoto CA, Aroian RV.
RAB-5- and RAB-11-dependent vesicle-trafficking pathways are required for plasma membrane repair after attack by bacterial pore-forming toxin.
Cell Host Microbe 2011 9(2) 147-57 
[ PubMed ID = 21320697 ] [ RRC reference ]

Kage-Nakadai E, Kobuna H, Funatsu O, Otori M, Gengyo-Ando K, Yoshina S, Hori S, Mitani S.
Single/low-copy integration of transgenes in Caenorhabditis elegans using an ultraviolet trimethylpsoralen method.
BMC Biotechnol 2012 12 1 
[ PubMed ID = 22217006 ] [ RRC reference ]

Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H.
Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis.
Proc Natl Acad Sci U S A 2014 111(11) E978-87 
[ PubMed ID = 24591580 ] [ RRC reference ]

Kage-Nakadai E, Imae R, Yoshina S, Mitani S.
Methods for single/low-copy integration by ultraviolet and trimethylpsoralen treatment in Caenorhabditis elegans.
Methods 2014 68(3) 397-402 
[ PubMed ID = 24613935 ] [ RRC reference ]

Kage-Nakadai E, Imae R, Suehiro Y, Yoshina S, Hori S, Mitani S.
A conditional knockout toolkit for Caenorhabditis elegans based on the Cre/loxP recombination.
PLoS One 2014 9(12) e114680 
[ PubMed ID = 25474529 ] [ RRC reference ]

Delahaye JL, Foster OK, Vine A, Saxton DS, Curtin TP, Somhegyi H, Salesky R, Hermann GJ.
Caenorhabditis elegans HOPS and CCZ-1 mediate trafficking to lysosome-related organelles independently of RAB-7 and SAND-1.
Mol Biol Cell 2014 25(7) 1073-96 
[ PubMed ID = 24501423 ] [ RRC reference ]

Gengyo-Ando K, Kuroyanagi H, Kobayashi T, Murate M, Fujimoto K, Okabe S, Mitani S.
The SM protein VPS-45 is required for RAB-5-dependent endocytic transport in Caenorhabditis elegans.
EMBO Rep 2007 8(2) 152-7 
[ PubMed ID = 17235359 ] [ RRC reference ]

Hermann GJ, Schroeder LK, Hieb CA, Kershner AM, Rabbitts BM, Fonarev P, Grant BD, Priess JR.
Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Mol Biol Cell 2005 16(7) 3273-88 
[ PubMed ID = 15843430 ] [ RRC reference ]