分離済み変異体

tm2438

Allele Nametm2438
BalanceNot Required
OutCrossNot Accepted
Sequence NameH24K24.5
Gene Namefmo-5
Worm BaseAllele Name tm2438
Gene Name fmo-5
Sequence H24K24.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2375/2376-2671/2672 (296 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(38..370, 1245..1626, 2035..2160, 2210..2524, 3032..3275, 3322..3416, 4144..4205))
Map position-19.95
Balancer
Map position of balancer
Sequence of primersExtFwd:CTAACACGGAGCAAGACATA,IntRev:AGACGGAGCCTAAGATTCAG,IntFwd:CGGGCGTCCAATTTCCGAAC,ExtRev:GATAGCCGTGATGTAAGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Said M, Freire R, Cabreiro F, Serrano-Contreras JI, Thompson EP, Everett JR.
Phenotypic and metabonomics studies of FMOs in C. elegans and their roles in lifespan extension.
Metabolomics 2025 21(6) 170 
[ PubMed ID = 41241700 ] [ RRC reference ]

Said M, Ferrara BT, Aprodu A, Cabreiro F, Thompson EP, Everett J.
Transcriptional analysis of C. elegans fmos at different life stages and their roles in ageing.
Mol Genet Genomics 2024 299(1) 113 
[ PubMed ID = 39636438 ] [ RRC reference ]

Gujar MR, Stricker AM, Lundquist EA.
Flavin monooxygenases regulate Caenorhabditis elegans axon guidance and growth cone protrusion with UNC-6/Netrin signaling and Rac GTPases.
PLoS Genet 2017 13(8) e1006998 
[ PubMed ID = 28859089 ] [ RRC reference ]

Hirani N, Westenberg M, Seed PT, Petalcorin MI, Dolphin CT.
C. elegans flavin-containing monooxygenase-4 is essential for osmoregulation in hypotonic stress.
Biol Open. 2016 5(5) 537-49. 
[ PubMed ID = -1 ] [ RRC reference ]