| Allele Name | tm2438 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | H24K24.5 |
| Gene Name | fmo-5 |
| Worm Base | Allele Name |
tm2438
|
| Gene Name |
fmo-5
|
| Sequence |
H24K24.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 2375/2376-2671/2672 (296 bp deletion) |
| Chromosome | V |
| Putative gene structure | complement(join(38..370, 1245..1626, 2035..2160, 2210..2524, 3032..3275, 3322..3416, 4144..4205)) |
| Map position | -19.95 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CTAACACGGAGCAAGACATA,IntRev:AGACGGAGCCTAAGATTCAG,IntFwd:CGGGCGTCCAATTTCCGAAC,ExtRev:GATAGCCGTGATGTAAGCAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Said M, Freire R, Cabreiro F, Serrano-Contreras JI, Thompson EP, Everett JR. Phenotypic and metabonomics studies of FMOs in C. elegans and their roles in lifespan extension. Metabolomics 2025 21(6) 170
[ PubMed ID = 41241700 ]
[ RRC reference ]
|
Said M, Ferrara BT, Aprodu A, Cabreiro F, Thompson EP, Everett J. Transcriptional analysis of C. elegans fmos at different life stages and their roles in ageing. Mol Genet Genomics 2024 299(1) 113
[ PubMed ID = 39636438 ]
[ RRC reference ]
|
Gujar MR, Stricker AM, Lundquist EA. Flavin monooxygenases regulate Caenorhabditis elegans axon guidance and growth cone protrusion with UNC-6/Netrin signaling and Rac GTPases. PLoS Genet 2017 13(8) e1006998
[ PubMed ID = 28859089 ]
[ RRC reference ]
|
Hirani N, Westenberg M, Seed PT, Petalcorin MI, Dolphin CT. C. elegans flavin-containing monooxygenase-4 is essential for osmoregulation in hypotonic stress. Biol Open. 2016 5(5) 537-49.
[ PubMed ID = -1 ]
[ RRC reference ]
|
|