Home > Mutants (Isolated) > tm2438

Mutants (Isolated)

Allele Name		tm2438
Allele Type		Normal
Sequence Name		H24K24.5
Gene Name		fmo-5
Worm Base	Allele Name	tm2438
	Gene Name	fmo-5
	Sequence	H24K24.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2375/2376-2671/2672 (296 bp deletion)
Chromosome		V
Putative gene structure		complement(join(38..370, 1245..1626, 2035..2160, 2210..2524, 3032..3275, 3322..3416, 4144..4205))
Map position		-19.95
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CTAACACGGAGCAAGACATA,IntRev:AGACGGAGCCTAAGATTCAG,IntFwd:CGGGCGTCCAATTTCCGAAC,ExtRev:GATAGCCGTGATGTAAGCAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Hirani N, Westenberg M, Seed PT, Petalcorin MI, Dolphin CT. C. elegans flavin-containing monooxygenase-4 is essential for osmoregulation in hypotonic stress. Biol Open. 2016 5(5) 537-49.  [ PubMed ID = -1 ] [ RRC reference ] Gujar MR, Stricker AM, Lundquist EA. Flavin monooxygenases regulate Caenorhabditis elegans axon guidance and growth cone protrusion with UNC-6/Netrin signaling and Rac GTPases. PLoS Genet 2017 13(8) e1006998  [ PubMed ID = 28859089 ] [ RRC reference ]