Mutants (Isolated)

tm2428

Allele Nametm2428
Allele TypeNormal
Sequence NameF49E11.10
Gene Namescl-2
Worm BaseAllele Name tm2428
Gene Name scl-2
Sequence F49E11.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29730/29731-30005/30006 (275 bp deletion)
ChromosomeIV
Putative gene structurejoin(29678..29851, 29903..30040, 30211..30422, 30855..30954)
Map position7.63
Balancer
Map position of balancer
Sequence of primersIntFwd:TGTGGCGCTTGCTGTTGGCT,ExtFwd:CGCGTGATAAGACTCCTATA,IntRev:TGTACTGGCACACGACGGTT,ExtRev:TCACTTACTGCGGCTTGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262 
[ PubMed ID = 37141255 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Booth LN, Shi C, Tantilert C, Yeo RW, Miklas JW, Hebestreit K, Hollenhorst CN, Maures TJ, Buckley MT, Murphy CT, Brunet A.
Males induce premature demise of the opposite sex by multifaceted strategies.
Nat Aging 2022 2(9) 809-823 
[ PubMed ID = 37118502 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]