Mutants (Isolated)

tm2428

Allele Name

tm2428

Allele Type

Normal

Sequence Name

F49E11.10

Gene Name

scl-2

Worm Base

Allele Name

tm2428

Gene Name

scl-2

Sequence

F49E11.10

Phenotype

homozygous viable

Mutation site

29730/29731-30005/30006 (275 bp deletion)

Chromosome

Putative gene structure

join(29678..29851, 29903..30040, 30211..30422, 30855..30954)

Map position

7.63

Balancer

Map position of balancer

Sequence of primers

IntFwd:TGTGGCGCTTGCTGTTGGCT,ExtFwd:CGCGTGATAAGACTCCTATA,IntRev:TGTACTGGCACACGACGGTT,ExtRev:TCACTTACTGCGGCTTGTAC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ] [ RRC reference ]

Kim D, Trang K, Pees B, Karimzadegan S, Bodkhe R, Hammond S, Shapira M.
Identification of intestinal mediators of Caenorhabditis elegans DBL-1/BMP immune signaling shaping gut microbiome composition.
mBio 2025 16(3) e0370324
[ PubMed ID = 39878514 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799
[ PubMed ID = 38987544 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854
[ PubMed ID = 38878153 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262
[ PubMed ID = 37141255 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023
[ PubMed ID = 38045350 ] [ RRC reference ]

Booth LN, Shi C, Tantilert C, Yeo RW, Miklas JW, Hebestreit K, Hollenhorst CN, Maures TJ, Buckley MT, Murphy CT, Brunet A.
Males induce premature demise of the opposite sex by multifaceted strategies.
Nat Aging 2022 2(9) 809-823
[ PubMed ID = 37118502 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170
[ PubMed ID = 32560629 ] [ RRC reference ]