Mutants (Isolated)

tm2428

Allele Nametm2428
Allele TypeNormal
Sequence NameF49E11.10
Gene Namescl-2
Worm BaseAllele Name tm2428
Gene Name scl-2
Sequence F49E11.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 29730/29731-30005/30006 (275 bp deletion)
ChromosomeIV
Putative gene structurejoin(29678..29851, 29903..30040, 30211..30422, 30855..30954)
Map position7.63
Balancer
Map position of balancer
Sequence of primersIntFwd:TGTGGCGCTTGCTGTTGGCT,ExtFwd:CGCGTGATAAGACTCCTATA,IntRev:TGTACTGGCACACGACGGTT,ExtRev:TCACTTACTGCGGCTTGTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13  
[ PubMed ID = 39951337 ] [ RRC reference ]

Kim D, Trang K, Pees B, Karimzadegan S, Bodkhe R, Hammond S, Shapira M.
Identification of intestinal mediators of Caenorhabditis elegans DBL-1/BMP immune signaling shaping gut microbiome composition.
mBio 2025 16(3) e0370324 
[ PubMed ID = 39878514 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262 
[ PubMed ID = 37141255 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Booth LN, Shi C, Tantilert C, Yeo RW, Miklas JW, Hebestreit K, Hollenhorst CN, Maures TJ, Buckley MT, Murphy CT, Brunet A.
Males induce premature demise of the opposite sex by multifaceted strategies.
Nat Aging 2022 2(9) 809-823 
[ PubMed ID = 37118502 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]