Mutants (Isolated)

tm2411

Allele Name

tm2411

Sequence Name

T01A4.1b

CGC Name

gcy-28

Worm Base

Allele Name

tm2411

CGC Name

gcy-28

Sequence

T01A4.1b

Phenotype

homozygous viable. Dr. C. Bargmann: chemotaxis-defective to AWC odors, sensitive to osmotic stress. Dr. L. Avery: intact satiety behavior. Dr. T. Ishihara: defective in sensory integration and salt chemotaxis learning. Dr. I. Mori: weakly thermophilic.

Mutation site

40946/40947-41648/41649 (702 bp deletion)

Chromosome

Putative gene structure

join(38759..39049, 39420..39619, 40575..40719, 40788..40959, 41212..41367, 41872..42188, 42818..43055, 43302..43460, 43634..43869)

Map position

-1.17

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CCCAGTCCTGATTACGACTC,ExtRev:TCTTGCGTGCGTTCCTCAAC,IntFwd:TCACCGGAGCATGTATCGAT,IntRev:GCGTTCCTCAACAAGACCTT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Arey RN, Stein GM, Kaletsky R, Kauffman A, Murphy CT.
Activation of G_αq Signaling Enhances Memory Consolidation and Slows Cognitive Decline.
Neuron 2018 98(3) 562-574.e5
[ PubMed ID = 29656871 ] [ RRC reference ]

Uozumi T, Hirotsu T, Yoshida K, Yamada R, Suzuki A, Taniguchi G, Iino Y, Ishihara T.
Temporally-regulated quick activation and inactivation of Ras is important for olfactory behaviour.
Sci Rep 2012 2 500
[ PubMed ID = 22787558 ] [ RRC reference ]

Nishio N, Mohri-Shiomi A, Nishida Y, Hiramatsu N, Kodama-Namba E, Kimura KD, Kuhara A, Mori I.
A novel and conserved protein AHO-3 is required for thermotactic plasticity associated with feeding states in Caenorhabditis elegans.
Genes Cells 2012 17(5) 365-86
[ PubMed ID = 22512337 ] [ RRC reference ]

Shinkai Y, Yamamoto Y, Fujiwara M, Tabata T, Murayama T, Hirotsu T, Ikeda DD, Tsunozaki M, Iino Y, Bargmann CI, Katsura I, Ishihara T.
Behavioral choice between conflicting alternatives is regulated by a receptor guanylyl cyclase, GCY-28, and a receptor tyrosine kinase, SCD-2, in AIA interneurons of Caenorhabditis elegans.
J Neurosci 2011 31(8) 3007-15
[ PubMed ID = 21414922 ] [ RRC reference ]

Hallem EA, Spencer WC, McWhirter RD, Zeller G, Henz SR, Rätsch G, Miller DM 3rd, Horvitz HR, Sternberg PW, Ringstad N.
Receptor-type guanylate cyclase is required for carbon dioxide sensation by Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(1) 254-9
[ PubMed ID = 21173231 ] [ RRC reference ]

Mok CA, Healey MP, Shekhar T, Leroux MR, Héon E, Zhen M.
Mutations in a guanylate cyclase GCY-35/GCY-36 modify Bardet-Biedl syndrome-associated phenotypes in Caenorhabditis elegans.
PLoS Genet 2011 7(10) e1002335
[ PubMed ID = 22022287 ] [ RRC reference ]

Tsunozaki M, Chalasani SH, Bargmann CI.
A behavioral switch: cGMP and PKC signaling in olfactory neurons reverses odor preference in C. elegans.
Neuron 2008 59(6) 959-71
[ PubMed ID = 18817734 ] [ RRC reference ]