Mutants (Isolated)

tm241

Allele Nametm241
Sequence NameC18B12.3
CGC Namedsc-1
Worm BaseAllele Name tm241
CGC Name dsc-1
Sequence C18B12.3
Phenotypehomozygous viable. Dr. S. Hekimi: Development in press.
Mutation site25424/25425-27592/27593 (2168 bp deletion)
ChromosomeX
Putative gene structurecomplement(join (25273..25347, 26087..26269, 26997..27184, 27819..27887, 27933..28350))
Map position20.34
Balancer
Map position of balancer
Sequence of primersExtFwd:ATGCTCCTGTAGGCTTGGAA,IntFwd:TGTTCATTGGGAATTGGTCA,ExtRev:TTCGACTTTCCTGATCTCCC,IntRev:AGTGCAACAGGGAGCTCAAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Branicky R, Hekimi S.
Specification of muscle neurotransmitter sensitivity by a Paired-like homeodomain protein in Caenorhabditis elegans.
Development 2005 132(22) 4999-5009 
[ PubMed ID = 16236771 ] [ RRC reference ]