Mutants (Isolated)

tm2398

Allele Nametm2398
Allele TypeNormal
Sequence NameY22F5A.5
Gene Namelys-2
Worm BaseAllele Name tm2398
Gene Name lys-2
Sequence Y22F5A.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Herman: life span change by some bacteria.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26508/26509-26958/26959 (450 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(26287..26700, 26938..27363))
Map position2.45
Balancer
Map position of balancer
Sequence of primersExtRev:CAGAGAGTCTGCACTGGTAT,IntRev:AGACCACAAGAAATCGACTC,ExtFwd:TTACCCGCGTGGAAGGCTTG,IntFwd:CACCATCTGCCATATTGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]

Boehnisch C, Wong D, Habig M, Isermann K, Michiels NK, Roeder T, May RC, Schulenburg H.
Protist-type lysozymes of the nematode Caenorhabditis elegans contribute to resistance against pathogenic Bacillus thuringiensis.
PLoS One 2011 6(9) e24619 
[ PubMed ID = 21931778 ] [ RRC reference ]