Mutants (Isolated)

tm2398

Allele Nametm2398
BalanceNot Required
OutCrossNot Accepted
Sequence NameY22F5A.5
Gene Namelys-2
Worm BaseAllele Name tm2398
Gene Name lys-2
Sequence Y22F5A.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Herman: life span change by some bacteria.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 26508/26509-26958/26959 (450 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(26287..26700, 26938..27363))
Map position2.45
Balancer
Map position of balancer
Sequence of primersExtRev:CAGAGAGTCTGCACTGGTAT,IntRev:AGACCACAAGAAATCGACTC,ExtFwd:TTACCCGCGTGGAAGGCTTG,IntFwd:CACCATCTGCCATATTGACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Castiglioni VG, Olmo-Uceda MJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF.
Story of an infection: Viral dynamics and host responses in the Caenorhabditis elegans-Orsay virus pathosystem.
Sci Adv 2024 10(39) eadn5945 
[ PubMed ID = 39331715 ] [ RRC reference ]

Radeke LJ, Herman MA.
Identification and characterization of differentially expressed genes in Caenorhabditis elegans in response to pathogenic and nonpathogenic Stenotrophomonas maltophilia.
BMC Microbiol 2020 20(1) 170 
[ PubMed ID = 32560629 ] [ RRC reference ]

Boehnisch C, Wong D, Habig M, Isermann K, Michiels NK, Roeder T, May RC, Schulenburg H.
Protist-type lysozymes of the nematode Caenorhabditis elegans contribute to resistance against pathogenic Bacillus thuringiensis.
PLoS One 2011 6(9) e24619 
[ PubMed ID = 21931778 ] [ RRC reference ]