Mutants (Isolated)

tm239

Allele Nametm239
Sequence NameC33D12.1
CGC Nameceh-31
Worm BaseAllele Name tm239
CGC Name ceh-31
Sequence C33D12.1
Phenotypehomozygous viable. Dr. J.K. Liu: no defects in the M lineage. Dr. R. Waterston: Dead eggs <10%.
Mutation site27769/27770-[F52E4]443/444 (713 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(26911..27480, 27875..28145, 364..618))
Map position-11.91
Balancer
Map position of balancer
Sequence of primersIntRev:AAAGCTCGGAAAACGTTTACA,ExtFwd:GGATTTTGAGAATGAGGGCA,ExtRev:CCAGACTATTGCAAACTCGG,IntFwd:ACAGAATCAGGAGATACTGATG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gaertner BE, Parmenter MD, Rockman MV, Kruglyak L, Phillips PC.
More than the sum of its parts: a complex epistatic network underlies natural variation in thermal preference behavior in Caenorhabditis elegans.
Genetics 2012 192(4) 1533-42 
[ PubMed ID = 23086219 ] [ RRC reference ]