分離済み変異体

tm238

Allele Nametm238
BalanceNot Required
OutCrossNot Accepted
Sequence NameC36F7.1
Gene Nameirx-1
Worm BaseAllele Name tm238
Gene Name irx-1
Sequence C36F7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable; Dr. H. Sawa: 0% Psa (n=98); Dr. J-L. Bessereau: deletion is within an intron and does not affect gene expression. Dr. D. Portman: male tail appears grossly normal. Dr. D.M. Miller: no gross phenotype is found unlike tm3354.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 1604/1605-1953/1954 (349 bp deletion)
ChromosomeI
Putative gene structurecomplement (join(325..552, 1053..1412, 2008..2469, 3002..3022))
Map position3.78
Balancer
Map position of balancer
Sequence of primersIntFwd:ATGTACAAGCACGCACGGT,ExtFwd:CTGAGCGTCACGACAGGATA,IntRev:GCTTATCACTGAATCGCTCC,ExtRev:GTTGTTGAACATAAGGTCCC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
McDiarmid TA, Belmadani M, Liang J, Meili F, Mathews EA, Mullen GP, Hendi A, Wong WR, Rand JB, Mizumoto K, Haas K, Pavlidis P, Rankin CH.
Systematic phenomics analysis of autism-associated genes reveals parallel networks underlying reversible impairments in habituation.
Proc Natl Acad Sci U S A 2020 117(1) 656-667 
[ PubMed ID = 31754030 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]