Allele Name | tm2355 |
Allele Type | 通常株 |
Sequence Name | F32A6.2 |
Gene Name | ift-81 |
Worm Base | Allele Name |
tm2355
|
Gene Name |
ift-81
|
Sequence |
F32A6.2
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. S. Mitani: Genes to Cells 12, 593 (2007). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 15745/15746-TTTTTTCTTT-16095/16096 (340 bp deletion) |
Chromosome | X |
Putative gene structure | join(13454..13584, 14178..14297, 14355..14478, 14751..14831, 14919..15073, 15838..15922, 16160..16378) |
Map position | -5.73 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:GGCCTGTATCGGTATTGCTT ,ExtRev:CGCACTGAATTGGACCTTGC ,IntFwd:GCTATGCAAGTGCAGATAGA ,IntRev:GGCTGTCAGCTCTTTCAACT |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Maurya AK, Rogers T, Sengupta P. A CCRK and a MAK Kinase Modulate Cilia Branching and Length via Regulation of Axonemal Microtubule Dynamics in Caenorhabditis elegans. Curr Biol 2019 29(8) 1286-1300.e4
[ PubMed ID = 30955935 ]
[ RRC reference ]
|
Hao L, Thein M, Brust-Mascher I, Civelekoglu-Scholey G, Lu Y, Acar S, Prevo B, Shaham S, Scholey JM. Intraflagellar transport delivers tubulin isotypes to sensory cilium middle and distal segments. Nat Cell Biol 2011 13(7) 790-8
[ PubMed ID = 21642982 ]
[ RRC reference ]
|
Kobayashi T, Gengyo-Ando K, Ishihara T, Katsura I, Mitani S. IFT-81 and IFT-74 are required for intraflagellar transport in C. elegans. Genes Cells 2007 12(5) 593-602
[ PubMed ID = 17535250 ]
[ RRC reference ]
|
|