Mutants (Isolated)

tm2350

Allele Nametm2350
Sequence NameC14C11.3
CGC Namehex-2
Worm BaseAllele Name tm2350
CGC Name hex-2
Sequence C14C11.3
Phenotypehomozygous viable. Dr. I. Wilson: J. Biol. Chem. 282, 27825 (2007).
Mutation site13237/13238-GTGT-13704/13705 (467 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurejoin(11880..11930, 12328..12513, 12568..12651, 13331..13783, 13832..13962, 14461..14582, 14626..14768, 15035..15287, 15335..15542, 15816..15975)
Map position-1.31
Balancer
Map position of balancer
Sequence of primersExtFwd:CACGCCTCATTTTCGATAGT,ExtRev:CATGGGGCTCCAGGTGAACT,IntFwd:AGCTTGTACTTTGAGCGTAG,IntRev:CACTGTGTAGAATCTCCGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yan S, Bleuler-Martinez S, Plaza DF, Künzler M, Aebi M, Joachim A, Razzazi-Fazeli E, Jantsch V, Geyer R, Wilson IB, Paschinger K.
Galactosylated fucose epitopes in nematodes: increased expression in a Caenorhabditis mutant associated with altered lectin sensitivity and occurrence in parasitic species.
J. Biol. Chem. 2012 287(34) 28276-90 
[ PubMed ID = 22733825 ] [ RRC reference ]

Paschinger K, Gutternigg M, Rendić D, Wilson IB.
The N-glycosylation pattern of Caenorhabditis elegans.
Carbohydr. Res. 2008 343(12) 2041-9 
[ PubMed ID = 18226806 ] [ RRC reference ]

Gutternigg M, Kretschmer-Lubich D, Paschinger K, Rendić D, Hader J, Geier P, Ranftl R, Jantsch V, Lochnit G, Wilson IB.
Biosynthesis of truncated N-linked oligosaccharides results from non-orthologous hexosaminidase-mediated mechanisms in nematodes, plants, and insects.
J. Biol. Chem. 2007 282(38) 27825-40 
[ PubMed ID = 17636254 ] [ RRC reference ]