Mutants (Isolated)

tm2314

Allele Nametm2314
BalanceCompleted
OutCrossNot Accepted
Sequence NameK02F2.2
Gene Nameahcy-1
Worm BaseAllele Name tm2314 (x1)
Gene Name ahcy-1
Sequence K02F2.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 32137/32138-32473/32474 (336 bp deletion)
ChromosomeI
Putative gene structurejoin(31518..31739, 31808..32563, 32632..32967)
Map position1.36
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntFwd:AGACCACCACTGGAGTCCAC,ExtFwd:GTACCCACAATACCTCGCTG,ExtRev:TGTATGGTCCGGCAACTGGA,IntRev:TGCTCGTCGGAAAGCTTAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]