Mutants (Isolated)

tm2312

Allele Nametm2312
Sequence NameY47G6A.10
CGC Namespg-7
Worm BaseAllele Name tm2312
CGC Name spg-7
Sequence Y47G6A.10
Phenotypelethal or sterile
Mutation site38042/38043-38437/38438 (395 bp deletion)
ChromosomeI
Putative gene structurejoin(34540..34659, 34709..34871, 34914..34986, 36692..36890, 36948..37072, 37988..39133, 39850..39958, 43924..44043, 44497..44706, 45062..45355)
Map position-3.22
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersIntRev:GTGCATATCCGAGACCCTTT,ExtRev:TACCGATCAAGCAACTGATC,IntFwd:CAAACCTCATCAGCGTCGCA,ExtFwd:CGCGAAATCCCAAACCTCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zubovych IO, Straud S, Roth MG.
Mitochondrial dysfunction confers resistance to multiple drugs in Caenorhabditis elegans.
Mol. Biol. Cell 2010 21(6) 956-69 
[ PubMed ID = 20089839 ] [ RRC reference ]

Chaudhari SN, Kipreos ET.
Increased mitochondrial fusion allows the survival of older animals in diverse C. elegans longevity pathways.
Nat Commun 2017 8(1) 182 
[ PubMed ID = 28769038 ] [ RRC reference ]