Mutants (Isolated)

tm2308

Allele Nametm2308
Sequence NameY116F11B.1
CGC Namedaf-28
Worm BaseAllele Name tm2308
CGC Name daf-28
Sequence Y116F11B.1
Phenotypehomozygous viable. Dr. P. Roy: abnormal muscle arm development. Dr. S. Tuck: Cell 128, 577-587 (2007).
Mutation site17272/17273-17428/17429 (156 bp deletion)
ChromosomeV
Putative gene structurejoin(17169..17370, 17780..17871)
Map position23.24
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCGCCCACTTTGAGCTATA,IntFwd:GGGTTATCACTAGGAAGTTG,ExtRev:GCACCCGATCTGACGACACT,IntRev:ACCGAGAGGTAGGGGTAATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fierro-González JC, Cornils A, Alcedo J, Miranda-Vizuete A, Swoboda P.
The thioredoxin TRX-1 modulates the function of the insulin-like neuropeptide DAF-28 during dauer formation in Caenorhabditis elegans.
PLoS ONE 2011 6(1) e16561 
[ PubMed ID = 21304598 ] [ RRC reference ]

Kulalert W, Sadeeshkumar H, Zhang YK, Schroeder FC, Kim DH.
Molecular Determinants of the Regulation of Development and Metabolism by Neuronal eIF2α Phosphorylation in Caenorhabditis elegans.
Genetics 2017 206(1) 251-263 
[ PubMed ID = 28292919 ] [ RRC reference ]

Patel DS, Fang LL, Svy DK, Ruvkun G, Li W.
Genetic identification of HSD-1, a conserved steroidogenic enzyme that directs larval development in Caenorhabditis elegans.
Development 2008 135(13) 2239-49 
[ PubMed ID = 18495818 ] [ RRC reference ]

Cornils A, Gloeck M, Chen Z, Zhang Y, Alcedo J.
Specific insulin-like peptides encode sensory information to regulate distinct developmental processes.
Development 2011 138(6) 1183-93 
[ PubMed ID = 21343369 ] [ RRC reference ]

Kao G, Nordenson C, Still M, Rönnlund A, Tuck S, Naredi P.
ASNA-1 positively regulates insulin secretion in C. elegans and mammalian cells.
Cell 2007 128(3) 577-87 
[ PubMed ID = 17289575 ] [ RRC reference ]

Kaul TK, Reis Rodrigues P, Ogungbe IV, Kapahi P, Gill MS.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
PLoS ONE 2014 9(1) e86979 
[ PubMed ID = 24475206 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358 
[ PubMed ID = 28839231 ] [ RRC reference ]

Yoshina S, Mitani S.
Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation.
PLoS ONE 2015 10(7) e0133966 
[ PubMed ID = 26218657 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr. Biol. 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]

Matsunaga Y, Honda Y, Honda S, Iwasaki T, Qadota H, Benian GM, Kawano T.
Diapause is associated with a change in the polarity of secretion of insulin-like peptides.
Nat Commun 2016 7 10573 
[ PubMed ID = 26838180 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet. 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J. 2018 37(15)  
[ PubMed ID = 29925517 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412 
[ PubMed ID = 25048458 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J. 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]