Mutants (Isolated)

tm2308

Allele Name

tm2308

Sequence Name

Y116F11B.1

CGC Name

daf-28

Worm Base

Allele Name

tm2308

CGC Name

daf-28

Sequence

Y116F11B.1

Phenotype

homozygous viable. Dr. P. Roy: abnormal muscle arm development. Dr. S. Tuck: Cell 128, 577-587 (2007).

Mutation site

17272/17273-17428/17429 (156 bp deletion)

Chromosome

Putative gene structure

join(17169..17370, 17780..17871)

Map position

23.24

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TCCGCCCACTTTGAGCTATA,IntFwd:GGGTTATCACTAGGAAGTTG,ExtRev:GCACCCGATCTGACGACACT,IntRev:ACCGAGAGGTAGGGGTAATT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9
[ PubMed ID = 32367802 ] [ RRC reference ]

Horowitz LB, Brandt JP, Ringstad N.
Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans.
Development 2019 146(22)
[ PubMed ID = 31628111 ] [ RRC reference ]

Kaplan REW, Webster AK, Chitrakar R, Dent JA, Baugh LR.
Food perception without ingestion leads to metabolic changes and irreversible developmental arrest in C. elegans.
BMC Biol 2018 16(1) 112
[ PubMed ID = 30296941 ] [ RRC reference ]

Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361
[ PubMed ID = 30425043 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)
[ PubMed ID = 29925517 ] [ RRC reference ]

Klabonski L, Zha J, Senthilkumar L, Gidalevitz T.
A Bystander Mechanism Explains the Specific Phenotype of a Broadly Expressed Misfolded Protein.
PLoS Genet 2016 12(12) e1006450
[ PubMed ID = 27926939 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet 2016 12(8) e1006237
[ PubMed ID = 27487365 ] [ RRC reference ]

Kaplan RE, Chen Y, Moore BT, Jordan JM, Maxwell CS, Schindler AJ, Baugh LR.
dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.
PLoS Genet 2015 11(12) e1005731
[ PubMed ID = 26656736 ] [ RRC reference ]

Greene JS, Dobosiewicz M, Butcher RA, McGrath PT, Bargmann CI.
Regulatory changes in two chemoreceptor genes contribute to a Caenorhabditis elegans QTL for foraging behavior.
Elife 2016 5
[ PubMed ID = 27893361 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705
[ PubMed ID = 27172180 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358
[ PubMed ID = 28839231 ] [ RRC reference ]

Kulalert W, Sadeeshkumar H, Zhang YK, Schroeder FC, Kim DH.
Molecular Determinants of the Regulation of Development and Metabolism by Neuronal eIF2α Phosphorylation in Caenorhabditis elegans.
Genetics 2017 206(1) 251-263
[ PubMed ID = 28292919 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85
[ PubMed ID = 23395381 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr Biol 2013 23(24) 2540-5
[ PubMed ID = 24316205 ] [ RRC reference ]

Kaul TK, Reis Rodrigues P, Ogungbe IV, Kapahi P, Gill MS.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
PLoS One 2014 9(1) e86979
[ PubMed ID = 24475206 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J 2013 32(12) 1745-60
[ PubMed ID = 23665919 ] [ RRC reference ]

Ohta A, Ujisawa T, Sonoda S, Kuhara A.
Light and pheromone-sensing neurons regulates cold habituation through insulin signalling in Caenorhabditis elegans.
Nat Commun 2014 5 4412
[ PubMed ID = 25048458 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79
[ PubMed ID = 24671950 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26
[ PubMed ID = 25128585 ] [ RRC reference ]

Yoshina S, Mitani S.
Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation.
PLoS One 2015 10(7) e0133966
[ PubMed ID = 26218657 ] [ RRC reference ]