Mutants (Isolated)

tm2308

Allele Nametm2308
Sequence NameY116F11B.1
CGC Namedaf-28
Worm BaseAllele Name tm2308
CGC Name daf-28
Sequence Y116F11B.1
Phenotypehomozygous viable. Dr. P. Roy: abnormal muscle arm development. Dr. S. Tuck: Cell 128, 577-587 (2007).
Mutation site17272/17273-17428/17429 (156 bp deletion)
ChromosomeV
Putative gene structurejoin(17169..17370, 17780..17871)
Map position23.24
Balancer
Map position of balancer
Sequence of primersExtFwd:TCCGCCCACTTTGAGCTATA,IntFwd:GGGTTATCACTAGGAAGTTG,ExtRev:GCACCCGATCTGACGACACT,IntRev:ACCGAGAGGTAGGGGTAATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Klabonski L, Zha J, Senthilkumar L, Gidalevitz T.
A Bystander Mechanism Explains the Specific Phenotype of a Broadly Expressed Misfolded Protein.
PLoS Genet. 2016 12(12) e1006450. 
[ PubMed ID = -1 ] [ RRC reference ]

Kaplan RE, Chen Y, Moore BT, Jordan JM, Maxwell CS, Schindler AJ, Baugh LR.
dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.
PLoS Genet. 2015 11(12) e1005731 
[ PubMed ID = 26656736 ] [ RRC reference ]

Greene JS, Dobosiewicz M, Butcher RA, McGrath PT, Bargmann CI.
Regulatory changes in two chemoreceptor genes contribute to a Caenorhabditis elegans QTL for foraging behavior.
Elife 2016 5  
[ PubMed ID = 27893361 ] [ RRC reference ]

Kulalert W, Sadeeshkumar H, Zhang YK, Schroeder FC, Kim DH.
Molecular Determinants of the Regulation of Development and Metabolism by Neuronal eIF2α Phosphorylation in Caenorhabditis elegans.
Genetics 2017 206(1) 251-263 
[ PubMed ID = 28292919 ] [ RRC reference ]

Horowitz LB, Brandt JP, Ringstad N.
Repression of an activity-dependent autocrine insulin signal is required for sensory neuron development in C. elegans.
Development 2019 146(22)  
[ PubMed ID = 31628111 ] [ RRC reference ]

Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361 
[ PubMed ID = 30425043 ] [ RRC reference ]

Kaul TK, Reis Rodrigues P, Ogungbe IV, Kapahi P, Gill MS.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
PLoS ONE 2014 9(1) e86979 
[ PubMed ID = 24475206 ] [ RRC reference ]

Park S, Paik YK.
Genetic deficiency in neuronal peroxisomal fatty acid β-oxidation causes the interruption of dauer development in Caenorhabditis elegans.
Sci Rep 2017 7(1) 9358 
[ PubMed ID = 28839231 ] [ RRC reference ]

Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet. 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Reis Rodrigues P, Kaul TK, Ho JH, Lucanic M, Burkewitz K, Mair WB, Held JM, Bohn LM, Gill MS.
Synthetic Ligands of Cannabinoid Receptors Affect Dauer Formation in the Nematode Caenorhabditis elegans.
G3 (Bethesda) 2016 6(6) 1695-705 
[ PubMed ID = 27172180 ] [ RRC reference ]

Kulalert W, Kim DH.
The unfolded protein response in a pair of sensory neurons promotes entry of C. elegans into dauer diapause.
Curr. Biol. 2013 23(24) 2540-5 
[ PubMed ID = 24316205 ] [ RRC reference ]

Yoshina S, Mitani S.
Loss of C. elegans GON-1, an ADAMTS9 Homolog, Decreases Secretion Resulting in Altered Lifespan and Dauer Formation.
PLoS ONE 2015 10(7) e0133966 
[ PubMed ID = 26218657 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J. 2018 37(15)  
[ PubMed ID = 29925517 ] [ RRC reference ]

Chen Z, Hendricks M, Cornils A, Maier W, Alcedo J, Zhang Y.
Two insulin-like peptides antagonistically regulate aversive olfactory learning in C. elegans.
Neuron 2013 77(3) 572-85 
[ PubMed ID = 23395381 ] [ RRC reference ]

Fukuyama M, Kontani K, Katada T, Rougvie AE.
The C. elegans Hypodermis Couples Progenitor Cell Quiescence to the Dietary State.
Curr. Biol. 2015 25(9) 1241-8 
[ PubMed ID = 25891400 ] [ RRC reference ]

Matsunaga Y, Honda Y, Honda S, Iwasaki T, Qadota H, Benian GM, Kawano T.
Diapause is associated with a change in the polarity of secretion of insulin-like peptides.
Nat Commun 2016 7 10573 
[ PubMed ID = 26838180 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Levi-Ferber M, Salzberg Y, Safra M, Haviv-Chesner A, Bülow HE, Henis-Korenblit S.
It's all in your mind: determining germ cell fate by neuronal IRE-1 in C. elegans.
PLoS Genet. 2014 10(10) e1004747 
[ PubMed ID = 25340700 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Fierro-González JC, Cornils A, Alcedo J, Miranda-Vizuete A, Swoboda P.
The thioredoxin TRX-1 modulates the function of the insulin-like neuropeptide DAF-28 during dauer formation in Caenorhabditis elegans.
PLoS ONE 2011 6(1) e16561 
[ PubMed ID = 21304598 ] [ RRC reference ]