| Allele Name | tm2298 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | T17H7.4 |
| Gene Name | pat-12 |
| Worm Base | Allele Name |
tm2298
(x1) |
| Gene Name |
pat-12
|
| Sequence |
T17H7.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. H. Sawa: Emb. Psa phenotype could not be checked. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 1491/1492-2010/2011 (519 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(52..118, 361..477, 530..839, 1295..1457, 1506..1606, 1993..2098, 2399..2557, 3005..3097, 3945..4031, 4089..4217, 4319..4339, 11740..11760, 12073..12171, 12221..12319, 12368..12502, 15398..15595, 18865..18980, 19033..19104,24756..24813)) |
| Map position | -26.24 |
| Balancer | sC1(s2023) [dpy-1(s2170) umnIs41] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TAGAACGATTGACGGACCTC,ExtRev:CAAGCCGCGCAGCATTATGA,IntFwd:CCTCTCCGTTTGGCACGTAC,IntRev:ACGATTTGGTGCGTCGTGAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Hetherington S, Gally C, Fritz JA, Polanowska J, Reboul J, Schwab Y, Zahreddine H, Behm C, Labouesse M. PAT-12, a potential anti-nematode target, is a new spectraplakin partner essential for Caenorhabditis elegans hemidesmosome integrity and embryonic morphogenesis. Dev Biol 2011 350(2) 267-78
[ PubMed ID = 21130760 ]
[ RRC reference ]
|
|