Allele Name | tm2279 |
Allele Type | 通常株 |
Sequence Name | F48D6.3 |
Gene Name | hlh-13 |
Worm Base | Allele Name |
tm2279
|
Gene Name |
hlh-13
|
Sequence |
F48D6.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. O. Hobert: ASE & AIY fate markers normal. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 4762/4763-5255/5256 (493 bp deletion) |
Chromosome | X |
Putative gene structure | join(4555..4740, 4801..4907, 5687..5775, 5823..5884) |
Map position | -7.86 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CACTTGATCACAAGTGCGAT,ExtRev:GTGGAGTCACGCATGACATT,IntFwd:ACCCATTCGTCTCTGTCTTT,IntRev:CTGCCGTTTACGCATACACA |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Maicas M, Jimeno-Martín Á, Millán-Trejo A, Alkema MJ, Flames N. The transcription factor LAG-1/CSL plays a Notch-independent role in controlling terminal differentiation, fate maintenance, and plasticity of serotonergic chemosensory neurons. PLoS Biol 2021 19(7) e3001334
[ PubMed ID = 34232959 ]
[ RRC reference ]
|
Luo S, Horvitz HR. The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage. Curr Biol 2017 27(5) 661-672
[ PubMed ID = 28238659 ]
[ RRC reference ]
|
Bou Dib P, Gnägi B, Daly F, Sabado V, Tas D, Glauser DA, Meister P, Nagoshi E. A conserved role for p48 homologs in protecting dopaminergic neurons from oxidative stress. PLoS Genet 2014 10(10) e1004718
[ PubMed ID = 25340742 ]
[ RRC reference ]
|
|