Mutants (Isolated)

tm2279

Allele Nametm2279
Allele TypeNormal
Sequence NameF48D6.3
Gene Namehlh-13
Worm BaseAllele Name tm2279
Gene Name hlh-13
Sequence F48D6.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. O. Hobert: ASE & AIY fate markers normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4762/4763-5255/5256 (493 bp deletion)
ChromosomeX
Putative gene structurejoin(4555..4740, 4801..4907, 5687..5775, 5823..5884)
Map position-7.86
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTTGATCACAAGTGCGAT,ExtRev:GTGGAGTCACGCATGACATT,IntFwd:ACCCATTCGTCTCTGTCTTT,IntRev:CTGCCGTTTACGCATACACA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Maicas M, Jimeno-Martín Á, Millán-Trejo A, Alkema MJ, Flames N.
The transcription factor LAG-1/CSL plays a Notch-independent role in controlling terminal differentiation, fate maintenance, and plasticity of serotonergic chemosensory neurons.
PLoS Biol 2021 19(7) e3001334 
[ PubMed ID = 34232959 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Bou Dib P, Gnägi B, Daly F, Sabado V, Tas D, Glauser DA, Meister P, Nagoshi E.
A conserved role for p48 homologs in protecting dopaminergic neurons from oxidative stress.
PLoS Genet 2014 10(10) e1004718 
[ PubMed ID = 25340742 ] [ RRC reference ]