Mutants (Isolated)

tm2261

Allele Nametm2261
Sequence NameB0432.5
CGC Namecat-2
Worm BaseAllele Name tm2261
CGC Name cat-2
Sequence B0432.5
Phenotypehomozygous viable. Dr. J.Y. Sze: no detectable dopamine by FIF assay.
Mutation site1777/1778-TGG-1988/1989 (211 bp deletion + 3 bp insertion)
ChromosomeII
Putative gene structureB0432.5a=join(459..503, 1288..1467, 1597..2081, 2129..2325, 2410..2684), B0432.5b=join(1453..1467, 1597..2081, 2129..2325, 2410..2680, 2935..3022, 3078..3278, 3499..3606)
Map position-15.67
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGAATGACGTCACTCCTAT,IntFwd:CTCACTTCCACTGACCCAAC,ExtRev:CGAATCTGAGGAATCCTATC,IntRev:AGGAATCCTATCCGCTGTCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bermingham DP, Hardaway JA, Refai O, Marks CR, Snider SL, Sturgeon SM, Spencer WC, Colbran RJ, Miller DM 3rd, Blakely RD.
The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism.
J. Neurosci. 2017 37(38) 9288-9304 
[ PubMed ID = 28842414 ] [ RRC reference ]

Hardaway JA, Wang J, Fleming PA, Fleming KA, Whitaker SM, Nackenoff A, Snarrenberg CL, Hardie SL, Zhang B, Blakely RD.
An open-source analytical platform for analysis of C. elegans swimming-induced paralysis.
J. Neurosci. Methods 2014 232 58-62 
[ PubMed ID = 24792527 ] [ RRC reference ]

Suo S, Ishiura S.
Dopamine modulates acetylcholine release via octopamine and CREB signaling in Caenorhabditis elegans.
PLoS ONE 2013 8(8) e72578 
[ PubMed ID = 23977320 ] [ RRC reference ]

Hardaway JA, Hardie SL, Whitaker SM, Baas SR, Zhang B, Bermingham DP, Lichtenstein AJ, Blakely RD.
Forward genetic analysis to identify determinants of dopamine signaling in Caenorhabditis elegans using swimming-induced paralysis.
G3 (Bethesda) 2012 2(8) 961-75 
[ PubMed ID = 22908044 ] [ RRC reference ]

Lee J, Jee C, McIntire SL.
Ethanol preference in C. elegans.
Genes Brain Behav. 2009 8(6) 578-85 
[ PubMed ID = 19614755 ] [ RRC reference ]

Yamazoe-Umemoto A, Fujita K, Iino Y, Iwasaki Y, Kimura KD.
Modulation of different behavioral components by neuropeptide and dopamine signalings in non-associative odor learning of Caenorhabditis elegans.
Neurosci. Res. 2015 99 22-33 
[ PubMed ID = 26068898 ] [ RRC reference ]

Dierking K, Polanowska J, Omi S, Engelmann I, Gut M, Lembo F, Ewbank JJ, Pujol N.
Unusual regulation of a STAT protein by an SLC6 family transporter in C. elegans epidermal innate immunity.
Cell Host Microbe 2011 9(5) 425-35 
[ PubMed ID = 21575913 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res. 2011 1393 91-9 
[ PubMed ID = 21529784 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J. Neurosci. 2015 35(25) 9409-23 
[ PubMed ID = 26109664 ] [ RRC reference ]