分離済み変異体

tm2261

Allele Name

tm2261

Balance

Not Required

OutCross

Not Accepted

Sequence Name

B0432.5

Gene Name

cat-2

Worm Base

Allele Name

tm2261

Gene Name

cat-2

Sequence

B0432.5

Phenotype

homozygous viable. Dr. J.Y. Sze: no detectable dopamine by FIF assay.

Mutation site

1777/1778-TGG-1988/1989 (211 bp deletion + 3 bp insertion)

Chromosome

Putative gene structure

B0432.5a=join(459..503, 1288..1467, 1597..2081, 2129..2325, 2410..2684), B0432.5b=join(1453..1467, 1597..2081, 2129..2325, 2410..2680, 2935..3022, 3078..3278, 3499..3606)

Map position

-15.67

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GCGAATGACGTCACTCCTAT,IntFwd:CTCACTTCCACTGACCCAAC,ExtRev:CGAATCTGAGGAATCCTATC,IntRev:AGGAATCCTATCCGCTGTCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Refai O, Rodriguez P, Gichi Z, Blakely RD.
Forward genetic screen of the C. elegans million mutation library reveals essential, cell-autonomous contributions of BBSome proteins to dopamine signaling.
J Neurochem 2024 168(9) 2073-2091
[ PubMed ID = 39118406 ] [ RRC reference ]

Tee LF, Young JJ, Maruyama K, Kimura S, Suzuki R, Endo Y, Kimura KD.
Electric shock causes a fleeing-like persistent behavioral response in the nematode Caenorhabditis elegans.
Genetics 2023 225(2)
[ PubMed ID = 37595066 ] [ RRC reference ]

Katzen A, Chung HK, Harbaugh WT, Della Iacono C, Jackson N, Glater EE, Taylor CJ, Yu SK, Flavell SW, Glimcher PW, Andreoni J, Lockery SR.
The nematode worm C. elegans chooses between bacterial foods as if maximizing economic utility.
Elife 2023 12
[ PubMed ID = 37096663 ] [ RRC reference ]

Dekkers MPJ, Salfelder F, Sanders T, Umuerri O, Cohen N, Jansen G.
Plasticity in gustatory and nociceptive neurons controls decision making in C. elegans salt navigation.
Commun Biol 2021 4(1) 1053
[ PubMed ID = 34504291 ] [ RRC reference ]

Yan J, Zhao N, Yang Z, Li Y, Bai H, Zou W, Zhang K, Huang X.
A trade-off switch of two immunological memories in Caenorhabditis elegans reinfected by bacterial pathogens.
J Biol Chem 2020 295(50) 17323-17336
[ PubMed ID = 33051209 ] [ RRC reference ]

Suo S, Harada K, Matsuda S, Kyo K, Wang M, Maruyama K, Awaji T, Tsuboi T.
Sexually Dimorphic Regulation of Behavioral States by Dopamine in Caenorhabditis elegans.
J Neurosci 2019 39(24) 4668-4683
[ PubMed ID = 30988167 ] [ RRC reference ]

Bermingham DP, Hardaway JA, Refai O, Marks CR, Snider SL, Sturgeon SM, Spencer WC, Colbran RJ, Miller DM 3rd, Blakely RD.
The Atypical MAP Kinase SWIP-13/ERK8 Regulates Dopamine Transporters through a Rho-Dependent Mechanism.
J Neurosci 2017 37(38) 9288-9304
[ PubMed ID = 28842414 ] [ RRC reference ]

Nagashima T, Oami E, Kutsuna N, Ishiura S, Suo S.
Dopamine regulates body size in Caenorhabditis elegans.
Dev Biol 2016 412(1) 128-138
[ PubMed ID = 26921458 ] [ RRC reference ]

Yamazoe-Umemoto A, Fujita K, Iino Y, Iwasaki Y, Kimura KD.
Modulation of different behavioral components by neuropeptide and dopamine signalings in non-associative odor learning of Caenorhabditis elegans.
Neurosci Res 2015 99 22-33
[ PubMed ID = 26068898 ] [ RRC reference ]

Hardaway JA, Sturgeon SM, Snarrenberg CL, Li Z, Xu XZ, Bermingham DP, Odiase P, Spencer WC, Miller DM 3rd, Carvelli L, Hardie SL, Blakely RD.
Glial Expression of the Caenorhabditis elegans Gene swip-10 Supports Glutamate Dependent Control of Extrasynaptic Dopamine Signaling.
J Neurosci 2015 35(25) 9409-23
[ PubMed ID = 26109664 ] [ RRC reference ]

Hardaway JA, Wang J, Fleming PA, Fleming KA, Whitaker SM, Nackenoff A, Snarrenberg CL, Hardie SL, Zhang B, Blakely RD.
An open-source analytical platform for analysis of C. elegans swimming-induced paralysis.
J Neurosci Methods 2014 232 58-62
[ PubMed ID = 24792527 ] [ RRC reference ]

Suo S, Ishiura S.
Dopamine modulates acetylcholine release via octopamine and CREB signaling in Caenorhabditis elegans.
PLoS One 2013 8(8) e72578
[ PubMed ID = 23977320 ] [ RRC reference ]

Hardaway JA, Hardie SL, Whitaker SM, Baas SR, Zhang B, Bermingham DP, Lichtenstein AJ, Blakely RD.
Forward genetic analysis to identify determinants of dopamine signaling in Caenorhabditis elegans using swimming-induced paralysis.
G3 (Bethesda) 2012 2(8) 961-75
[ PubMed ID = 22908044 ] [ RRC reference ]

Karmacharya R, Lynn SK, Demarco S, Ortiz A, Wang X, Lundy MY, Xie Z, Cohen BM, Miller GM, Buttner EA.
Behavioral effects of clozapine: involvement of trace amine pathways in C. elegans and M. musculus.
Brain Res 2011 1393 91-9
[ PubMed ID = 21529784 ] [ RRC reference ]

Dierking K, Polanowska J, Omi S, Engelmann I, Gut M, Lembo F, Ewbank JJ, Pujol N.
Unusual regulation of a STAT protein by an SLC6 family transporter in C. elegans epidermal innate immunity.
Cell Host Microbe 2011 9(5) 425-35
[ PubMed ID = 21575913 ] [ RRC reference ]

Lee J, Jee C, McIntire SL.
Ethanol preference in C. elegans.
Genes Brain Behav 2009 8(6) 578-85
[ PubMed ID = 19614755 ] [ RRC reference ]