Mutants (Isolated)

tm2258

Allele Nametm2258
Sequence NameF59F5.1
CGC Nameslcf-1
Worm BaseAllele Name tm2258
CGC Name slcf-1
Sequence F59F5.1
Phenotypehomozygous viable
Mutation site895/896-1560/1561 (665 bp deletion)
ChromosomeX
Putative gene structurejoin(263..268, 314..419, 466..606, 657..808, 854..982, 1034..1149, 1198..1279, 1512..1635, 1682..2079)
Map position2.23
Balancer
Map position of balancer
Sequence of primersIntRev:GCAACTCGCACAGAAGGCAA,ExtRev:GATACGGTTGCTTGTGACGT,IntFwd:CCAAGCCGATACTGCGGTTT,ExtFwd:ACGGATTTGTCGAGCCTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pontoizeau C, Mouchiroud L, Molin L, Mergoud-Dit-Lamarche A, Dallière N, Toulhoat P, Elena-Herrmann B, Solari F.
Metabolomics analysis uncovers that dietary restriction buffers metabolic changes associated with aging in Caenorhabditis elegans.
J. Proteome Res. 2014 13(6) 2910-9 
[ PubMed ID = 24819046 ] [ RRC reference ]

Wong A, Li X, Molin L, Solari F, Elena-Herrmann B, Sakellariou D.
μHigh resolution-magic-angle spinning NMR spectroscopy for metabolic phenotyping of Caenorhabditis elegans.
Anal. Chem. 2014 86(12) 6064-70 
[ PubMed ID = 24897622 ] [ RRC reference ]

Mouchiroud L, Molin L, Kasturi P, Triba MN, Dumas ME, Wilson MC, Halestrap AP, Roussel D, Masse I, Dallière N, Ségalat L, Billaud M, Solari F.
Pyruvate imbalance mediates metabolic reprogramming and mimics lifespan extension by dietary restriction in Caenorhabditis elegans.
Aging Cell 2011 10(1) 39-54 
[ PubMed ID = 21040400 ] [ RRC reference ]

Butler JA, Mishur RJ, Bhaskaran S, Rea SL.
A metabolic signature for long life in the Caenorhabditis elegans Mit mutants.
Aging Cell 2013 12(1) 130-8 
[ PubMed ID = 23173729 ] [ RRC reference ]

Shafaq-Zadah M, Brocard L, Solari F, Michaux G.
AP-1 is required for the maintenance of apico-basal polarity in the C. elegans intestine.
Development 2012 139(11) 2061-70 
[ PubMed ID = 22535414 ] [ RRC reference ]