分離済み変異体

tm2258

Allele Nametm2258
BalanceNot Required
OutCrossNot Accepted
Sequence NameF59F5.1
Gene Nameslcf-1
Worm BaseAllele Name tm2258
Gene Name slcf-1
Sequence F59F5.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 895/896-1560/1561 (665 bp deletion)
ChromosomeX
Putative gene structurejoin(263..268, 314..419, 466..606, 657..808, 854..982, 1034..1149, 1198..1279, 1512..1635, 1682..2079)
Map position2.23
Balancer
Map position of balancer
Sequence of primersIntRev:GCAACTCGCACAGAAGGCAA,ExtRev:GATACGGTTGCTTGTGACGT,IntFwd:CCAAGCCGATACTGCGGTTT,ExtFwd:ACGGATTTGTCGAGCCTGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wong A, Li X, Molin L, Solari F, Elena-Herrmann B, Sakellariou D.
μHigh resolution-magic-angle spinning NMR spectroscopy for metabolic phenotyping of Caenorhabditis elegans.
Anal Chem 2014 86(12) 6064-70 
[ PubMed ID = 24897622 ] [ RRC reference ]

Pontoizeau C, Mouchiroud L, Molin L, Mergoud-Dit-Lamarche A, Dallière N, Toulhoat P, Elena-Herrmann B, Solari F.
Metabolomics analysis uncovers that dietary restriction buffers metabolic changes associated with aging in Caenorhabditis elegans.
J Proteome Res 2014 13(6) 2910-9 
[ PubMed ID = 24819046 ] [ RRC reference ]

Butler JA, Mishur RJ, Bhaskaran S, Rea SL.
A metabolic signature for long life in the Caenorhabditis elegans Mit mutants.
Aging Cell 2013 12(1) 130-8 
[ PubMed ID = 23173729 ] [ RRC reference ]

Shafaq-Zadah M, Brocard L, Solari F, Michaux G.
AP-1 is required for the maintenance of apico-basal polarity in the C. elegans intestine.
Development 2012 139(11) 2061-70 
[ PubMed ID = 22535414 ] [ RRC reference ]

Mouchiroud L, Molin L, Kasturi P, Triba MN, Dumas ME, Wilson MC, Halestrap AP, Roussel D, Masse I, Dallière N, Ségalat L, Billaud M, Solari F.
Pyruvate imbalance mediates metabolic reprogramming and mimics lifespan extension by dietary restriction in Caenorhabditis elegans.
Aging Cell 2011 10(1) 39-54 
[ PubMed ID = 21040400 ] [ RRC reference ]